Incidental Mutation 'R0413:Vsx2'
ID212499
Institutional Source Beutler Lab
Gene Symbol Vsx2
Ensembl Gene ENSMUSG00000021239
Gene Namevisual system homeobox 2
SynonymsHox10, Chx10, Hox-10
MMRRC Submission 038615-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.787) question?
Stock #R0413 (G1)
Quality Score54
Status Validated
Chromosome12
Chromosomal Location84569762-84595457 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84570003 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 21 (T21S)
Ref Sequence ENSEMBL: ENSMUSP00000131009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021665] [ENSMUST00000169934]
Predicted Effect probably benign
Transcript: ENSMUST00000021665
AA Change: T21S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021665
Gene: ENSMUSG00000021239
AA Change: T21S

DomainStartEndE-ValueType
low complexity region 77 86 N/A INTRINSIC
low complexity region 122 132 N/A INTRINSIC
HOX 148 210 4e-26 SMART
low complexity region 284 295 N/A INTRINSIC
Pfam:OAR 299 319 4.3e-10 PFAM
low complexity region 334 350 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169934
AA Change: T21S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131009
Gene: ENSMUSG00000021239
AA Change: T21S

DomainStartEndE-ValueType
low complexity region 77 86 N/A INTRINSIC
low complexity region 122 132 N/A INTRINSIC
HOX 148 210 4e-26 SMART
low complexity region 303 314 N/A INTRINSIC
Pfam:OAR 319 337 6.6e-10 PFAM
low complexity region 353 369 N/A INTRINSIC
Meta Mutation Damage Score 0.0578 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: This gene encodes a member of the Vsx (visual system homeobox) family which belongs to the larger PRD homeobox class. The encoded protein is required for eye organogenesis and controls retinal development. Disruption of this gene is associated with ocular retardation J (orJ), a mouse disease which causes microphthalmia, retinal degeneration and optic nerve aplasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit microphthalmia, lack of retinal intercellular channels, and agenesis of the optic nerve. Homozygotes for one mutant allele also have a germ cell maturation defect with sterility in both sexes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A G 2: 69,328,011 probably benign Het
Adh1 C T 3: 138,280,432 T60I probably benign Het
Agtpbp1 T A 13: 59,514,152 I282F probably damaging Het
AI464131 G T 4: 41,498,585 H348Q probably benign Het
Arih2 G T 9: 108,616,717 Q166K probably damaging Het
BC027072 T G 17: 71,752,217 D155A probably benign Het
Cacna1s A G 1: 136,098,209 T1031A probably benign Het
Ccdc102a C A 8: 94,903,286 E542D probably benign Het
Cdk1 T C 10: 69,345,099 I94V probably benign Het
Cep290 C T 10: 100,523,314 Q969* probably null Het
Cilp2 A G 8: 69,882,993 S452P probably benign Het
Col12a1 T C 9: 79,699,360 T594A probably damaging Het
Cpox A G 16: 58,670,869 T148A possibly damaging Het
Csf3r A G 4: 126,039,667 probably benign Het
Csmd1 A T 8: 16,710,514 C202S probably damaging Het
Dlgap4 T C 2: 156,762,826 S261P probably damaging Het
Dnah9 T A 11: 66,108,135 Y1029F probably damaging Het
Dok5 T C 2: 170,829,960 probably benign Het
Dusp11 A T 6: 85,952,370 probably benign Het
Edar T C 10: 58,629,440 N34D probably benign Het
Efcab7 C T 4: 99,909,746 T56I probably damaging Het
Entpd1 G A 19: 40,711,285 V47I probably benign Het
Ephx4 A G 5: 107,403,735 N62S probably benign Het
Etaa1 A T 11: 17,946,350 L589* probably null Het
Fam135b T A 15: 71,463,821 N508I probably benign Het
Fam193a T C 5: 34,466,208 V27A possibly damaging Het
Fmnl1 A G 11: 103,194,063 probably benign Het
Fstl1 A C 16: 37,821,154 probably null Het
Gbp4 G A 5: 105,121,106 R394C possibly damaging Het
Gemin4 T C 11: 76,211,322 Y871C probably benign Het
Gm7247 T C 14: 51,523,472 V166A probably benign Het
Gpcpd1 A T 2: 132,564,623 probably benign Het
Gpnmb A G 6: 49,042,803 D36G probably benign Het
Ido2 C T 8: 24,558,143 probably null Het
Igfn1 G A 1: 135,967,596 T1744I probably benign Het
Inf2 T G 12: 112,601,676 F221V probably damaging Het
Itga10 T A 3: 96,649,059 I170N probably damaging Het
Lrp6 A T 6: 134,507,624 D345E probably damaging Het
Macf1 A T 4: 123,472,269 S2900T probably benign Het
Med13 C A 11: 86,299,207 probably benign Het
Morc3 T C 16: 93,870,474 V507A probably damaging Het
Myadm AC ACC 7: 3,296,760 probably null Het
Myl6 C T 10: 128,492,222 probably benign Het
Mylk T C 16: 34,921,944 V942A probably benign Het
Ncdn G T 4: 126,750,534 T165K possibly damaging Het
Ncf1 T C 5: 134,222,802 probably benign Het
Neb T C 2: 52,290,739 probably benign Het
Nid1 T A 13: 13,482,096 I604N probably benign Het
Nsrp1 T C 11: 77,046,171 R400G probably benign Het
Nup43 T G 10: 7,671,027 I137S probably benign Het
Nynrin A G 14: 55,872,191 N1585S possibly damaging Het
Obscn T A 11: 59,002,997 Y6748F probably benign Het
Olfr1058 G A 2: 86,385,714 R235C probably benign Het
Olfr1211 A G 2: 88,929,562 V251A probably benign Het
Olfr1389 T C 11: 49,431,385 V303A possibly damaging Het
Olfr60 A T 7: 140,345,195 S265T possibly damaging Het
Olfr623 A T 7: 103,660,750 F167I possibly damaging Het
Olfr67 A G 7: 103,788,155 Y41H probably damaging Het
Olfr944 A G 9: 39,218,270 I304M probably benign Het
Olfr992 T C 2: 85,399,675 N286S probably damaging Het
Omg A G 11: 79,502,835 S66P possibly damaging Het
Ormdl1 C T 1: 53,308,819 probably benign Het
Ovch2 T A 7: 107,782,036 I552L probably benign Het
Pcsk9 G T 4: 106,454,341 T231N probably damaging Het
Pgpep1 T C 8: 70,657,450 N22S probably damaging Het
Plb1 T C 5: 32,355,362 F1355L probably damaging Het
Plcg1 G T 2: 160,761,429 L1173F probably damaging Het
Plch2 A T 4: 155,006,916 probably null Het
Ppp1r3g T A 13: 35,969,348 F250L probably damaging Het
Prkcg A G 7: 3,319,579 I381V probably benign Het
Pum2 C T 12: 8,713,464 A207V probably benign Het
Rabac1 T C 7: 24,970,182 E166G probably damaging Het
Rad21l G A 2: 151,651,931 S450L probably benign Het
Rangap1 ACACTCA ACA 15: 81,716,675 probably null Het
Reg3b G T 6: 78,371,841 C40F probably damaging Het
Rfx2 A G 17: 56,784,418 probably benign Het
Rrp15 G A 1: 186,749,149 probably benign Het
Schip1 G T 3: 68,494,613 G36C probably damaging Het
Sec61a2 A T 2: 5,876,354 probably benign Het
Sema5a A G 15: 32,669,444 K705E probably damaging Het
Setx A G 2: 29,139,278 Y186C probably damaging Het
Slc22a23 T C 13: 34,183,132 E631G probably damaging Het
Slc5a5 T C 8: 70,891,675 T134A possibly damaging Het
Stx7 T C 10: 24,181,594 S173P probably damaging Het
Sybu T C 15: 44,673,272 T353A probably damaging Het
Syde2 T A 3: 146,007,132 N1008K probably damaging Het
Tiam1 T C 16: 89,809,365 probably benign Het
Timm10b G A 7: 105,678,330 E61K probably benign Het
Tm2d1 A G 4: 98,365,573 I121T probably damaging Het
Trim75 T C 8: 64,983,240 E186G probably benign Het
Tti1 T C 2: 157,995,476 K895E probably benign Het
Vmn1r43 A G 6: 89,869,848 S219P probably damaging Het
Vmn2r73 A T 7: 85,871,879 S294T possibly damaging Het
Vmn2r94 A T 17: 18,243,818 F737I probably damaging Het
Wrb T G 16: 96,153,017 S105R probably benign Het
Zfp462 G T 4: 55,010,534 R833S probably damaging Het
Zfpl1 G A 19: 6,082,452 P143L probably damaging Het
Other mutations in Vsx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03368:Vsx2 APN 12 84570300 missense probably benign 0.09
R0005:Vsx2 UTSW 12 84570241 missense possibly damaging 0.78
R1256:Vsx2 UTSW 12 84576311 missense probably damaging 1.00
R3438:Vsx2 UTSW 12 84570211 missense probably damaging 0.98
R5199:Vsx2 UTSW 12 84593210 missense probably benign 0.31
R6481:Vsx2 UTSW 12 84593104 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGATTGGCTGTTCAGCTCTGACCC -3'
(R):5'- CGACTGTGACTTTCCCAAGCAGTG -3'

Sequencing Primer
(F):5'- GGGCTCCAGAGCATTAGACAC -3'
(R):5'- TTTCCCAAGCAGTGTAGCAG -3'
Posted On2014-07-03