Incidental Mutation 'R0124:Stx3'
ID21251
Institutional Source Beutler Lab
Gene Symbol Stx3
Ensembl Gene ENSMUSG00000041488
Gene Namesyntaxin 3
SynonymsSyn-3, syntaxin 3B, syntaxin 3A
MMRRC Submission 038409-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0124 (G1)
Quality Score225
Status Validated (trace)
Chromosome19
Chromosomal Location11775118-11819403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11791799 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 54 (E54G)
Ref Sequence ENSEMBL: ENSMUSP00000037317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047698] [ENSMUST00000069285] [ENSMUST00000075304] [ENSMUST00000211047] [ENSMUST00000211641]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047698
AA Change: E54G

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037317
Gene: ENSMUSG00000041488
AA Change: E54G

DomainStartEndE-ValueType
SynN 27 146 5.39e-41 SMART
t_SNARE 186 253 1.07e-19 SMART
transmembrane domain 265 286 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000069285
AA Change: E54G

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000069529
Gene: ENSMUSG00000041488
AA Change: E54G

DomainStartEndE-ValueType
SynN 27 146 5.39e-41 SMART
t_SNARE 186 253 6.87e-18 SMART
transmembrane domain 264 286 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000075304
AA Change: E54G

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074776
Gene: ENSMUSG00000041488
AA Change: E54G

DomainStartEndE-ValueType
SynN 27 128 1.13e-16 SMART
t_SNARE 168 235 1.07e-19 SMART
transmembrane domain 247 268 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210481
Predicted Effect possibly damaging
Transcript: ENSMUST00000211047
AA Change: E54G

PolyPhen 2 Score 0.531 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000211641
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.7%
  • 20x: 89.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene is a member of the syntaxin family. The encoded protein is targeted to the apical membrane of epithelial cells where it forms clusters and is important in establishing and maintaining polarity necessary for protein trafficking involving vesicle fusion and exocytosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,161,674 T194A probably benign Het
Afap1 C T 5: 35,945,209 P82S probably damaging Het
Ankrd28 A G 14: 31,727,741 Y481H probably damaging Het
Arid1b C T 17: 5,339,330 T1717I probably damaging Het
Atad2b A G 12: 4,952,676 K348R probably benign Het
B020004J07Rik A G 4: 101,835,373 *477Q probably null Het
Bcl3 C T 7: 19,809,651 V5M probably damaging Het
C2cd3 A G 7: 100,469,518 E2321G probably benign Het
Casq1 C T 1: 172,210,425 V380M probably damaging Het
Cd209e T A 8: 3,851,274 T127S probably benign Het
Cdh23 G T 10: 60,308,056 Y2921* probably null Het
Cdh6 A G 15: 13,034,324 L750P probably damaging Het
Cdk12 T C 11: 98,211,247 probably benign Het
Ces5a T C 8: 93,528,555 E170G probably damaging Het
Clec4f A G 6: 83,652,353 probably null Het
Col19a1 T C 1: 24,526,458 N264S unknown Het
Col2a1 T A 15: 97,998,862 I43F unknown Het
Col4a2 A G 8: 11,408,871 probably benign Het
Csmd3 T A 15: 47,590,716 D3578V probably damaging Het
Cyp2c37 T C 19: 39,994,102 L128P probably damaging Het
Dysf A G 6: 84,065,102 probably benign Het
Eml1 T C 12: 108,506,608 V225A probably benign Het
Eml1 A G 12: 108,509,178 Y256C probably damaging Het
Epb41l5 T A 1: 119,633,640 K64* probably null Het
Fat2 A G 11: 55,283,678 F2070L probably damaging Het
Fbxw18 G T 9: 109,691,515 H259N probably benign Het
Gm10764 A T 10: 87,290,748 T6S unknown Het
Gm14412 A G 2: 177,315,912 probably benign Het
Heatr5b A T 17: 78,826,217 probably benign Het
Hid1 T C 11: 115,356,823 T250A probably damaging Het
Hnf4g A G 3: 3,643,082 probably benign Het
Ifnar1 C T 16: 91,499,537 Q309* probably null Het
Lrriq1 C T 10: 103,170,420 probably null Het
Map3k13 A G 16: 21,903,756 T223A possibly damaging Het
Matn2 C T 15: 34,426,151 probably benign Het
Myo6 A G 9: 80,307,774 E1253G probably damaging Het
Nomo1 G T 7: 46,083,228 probably benign Het
Olfr1221 A T 2: 89,111,744 I256K possibly damaging Het
Olfr160 A G 9: 37,711,463 V272A possibly damaging Het
Olfr356 A T 2: 36,937,256 I46F possibly damaging Het
Papolg C T 11: 23,867,535 A582T probably benign Het
Plekhm3 C T 1: 64,921,751 E449K probably damaging Het
Pole T G 5: 110,303,992 M900R probably damaging Het
Ppp1cb T A 5: 32,483,478 probably benign Het
Pros1 A G 16: 62,913,946 T372A possibly damaging Het
Scara3 A T 14: 65,931,221 S316T probably benign Het
St5 A G 7: 109,542,511 S132P possibly damaging Het
Stau2 C T 1: 16,463,128 A61T probably damaging Het
Sun1 T C 5: 139,246,679 probably benign Het
Swt1 A T 1: 151,391,529 C634S probably damaging Het
Syt6 A G 3: 103,587,526 Y269C probably damaging Het
Tfap2a G A 13: 40,717,411 probably benign Het
Tmx4 A T 2: 134,639,720 probably null Het
Ttc39d T C 17: 80,216,946 C345R probably damaging Het
Vmn1r27 T C 6: 58,215,248 Y257C probably damaging Het
Vmn2r27 T A 6: 124,231,619 T56S probably benign Het
Vps13b T C 15: 35,576,528 probably null Het
Wdr17 A G 8: 54,635,491 S1175P probably damaging Het
Wsb2 T C 5: 117,363,758 F63L probably benign Het
Zfp142 A G 1: 74,568,623 Y1561H probably damaging Het
Other mutations in Stx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Stx3 APN 19 11791788 missense probably damaging 0.99
IGL01578:Stx3 APN 19 11786605 missense probably damaging 1.00
IGL02086:Stx3 APN 19 11818682 splice site probably benign
IGL02487:Stx3 APN 19 11783105 missense probably damaging 0.96
R0573:Stx3 UTSW 19 11785746 missense probably damaging 1.00
R1739:Stx3 UTSW 19 11785523 missense probably damaging 1.00
R2869:Stx3 UTSW 19 11789574 missense probably damaging 0.99
R2869:Stx3 UTSW 19 11789574 missense probably damaging 0.99
R2870:Stx3 UTSW 19 11789574 missense probably damaging 0.99
R2870:Stx3 UTSW 19 11789574 missense probably damaging 0.99
R2874:Stx3 UTSW 19 11789574 missense probably damaging 0.99
R4864:Stx3 UTSW 19 11777151 missense possibly damaging 0.79
R6156:Stx3 UTSW 19 11803510 missense probably damaging 1.00
R7298:Stx3 UTSW 19 11790048 nonsense probably null
R7443:Stx3 UTSW 19 11791844 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TGCTCCCCTACTATCCCCAGAGCAG -3'
(R):5'- GCACACACCTGAAGGTGCAGAAGTG -3'

Sequencing Primer
(F):5'- TACTATCCCCAGAGCAGAGGAAAG -3'
(R):5'- ATGTGACCTTGCCGAGTC -3'
Posted On2013-04-11