Mutagenetix > Incidental Mutation

Incidental Mutation 'R0240:Espl1'

212512

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

038478-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0240 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 102312541 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 911 (S911P)

Ref Sequence

ENSEMBL: ENSMUSP00000155304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]

AlphaFold

P60330

Predicted Effect

probably benign
Transcript: ENSMUST00000064924
AA Change: S911P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: S911P

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000229050
AA Change: S911P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230116

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230120

Meta Mutation Damage Score

0.1689

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.3%

Validation Efficiency

100% (112/112)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 110 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	A	G	14: 49,768,402		probably benign	Het
Acsf3	T	C	8: 122,780,181	L71P	probably damaging	Het
Adamts2	A	T	11: 50,775,374	D399V	probably damaging	Het
Adck2	T	A	6: 39,583,818	V380E	probably benign	Het
Alg11	T	A	8: 22,065,452	V243D	possibly damaging	Het
Ankrd27	T	A	7: 35,619,439	L585Q	probably damaging	Het
Atp7a	T	A	X: 106,109,841	N1117K	probably damaging	Het
Cacna1b	G	A	2: 24,638,657		probably benign	Het
Cacna1d	T	A	14: 30,096,969	M1210L	probably benign	Het
Cacna1s	T	C	1: 136,073,496		probably benign	Het
Ccdc155	C	T	7: 45,200,251	A83T	probably benign	Het
Chd7	T	C	4: 8,852,670		probably benign	Het
Col12a1	A	T	9: 79,652,033	S1858T	probably benign	Het
Cotl1	C	T	8: 119,840,324	W26*	probably null	Het
Csmd3	T	C	15: 47,629,239	T3000A	probably benign	Het
Dcp1a	T	A	14: 30,484,594		probably benign	Het
Ddhd2	A	T	8: 25,739,590		probably null	Het
Dnah8	T	C	17: 30,765,679	I3117T	probably damaging	Het
Dnm3	G	T	1: 162,353,625	Q162K	probably benign	Het
Dpy19l2	G	T	9: 24,658,580	A359D	probably damaging	Het
Ece1	T	A	4: 137,949,435		probably benign	Het
Eif4g3	A	G	4: 138,170,562	K1025R	probably damaging	Het
Eml2	C	A	7: 19,184,872	Y82*	probably null	Het
Eml6	A	G	11: 29,792,367	V1057A	possibly damaging	Het
Eral1	A	G	11: 78,076,058		probably benign	Het
Fbxo8	A	G	8: 56,590,261		probably benign	Het
Flrt1	A	T	19: 7,097,110		probably benign	Het
Fndc7	A	G	3: 108,858,919		probably benign	Het
G3bp1	G	A	11: 55,492,028	G139D	probably damaging	Het
Gabra6	C	T	11: 42,314,947	V351I	probably benign	Het
Galc	A	T	12: 98,252,034	H186Q	probably damaging	Het
Ganab	A	G	19: 8,912,813	D702G	possibly damaging	Het
Gm13762	A	T	2: 88,973,396	L165Q	probably damaging	Het
Hdac10	T	C	15: 89,125,882	E291G	possibly damaging	Het
Hectd3	T	G	4: 117,002,613	V749G	probably damaging	Het
Kcnh1	T	A	1: 192,505,340	I703N	probably benign	Het
Kcnma1	G	A	14: 23,494,579	T505I	probably damaging	Het
Kctd11	A	G	11: 69,879,814	C133R	probably damaging	Het
Lama3	A	T	18: 12,539,823		probably null	Het
Lamb3	T	C	1: 193,335,027	L842P	probably damaging	Het
Ldlr	T	C	9: 21,737,999		probably benign	Het
Lipk	G	A	19: 34,046,810	R336H	probably benign	Het
Lrrc24	T	A	15: 76,723,209	D58V	probably damaging	Het
Lrsam1	A	G	2: 32,955,185	L106P	probably damaging	Het
Milr1	G	A	11: 106,754,896	W88*	probably null	Het
Mmp10	A	G	9: 7,506,543	D340G	probably damaging	Het
Mybpc1	T	A	10: 88,555,738	Y285F	possibly damaging	Het
Ncoa3	A	G	2: 166,054,400	T408A	probably benign	Het
Nefm	T	A	14: 68,121,134	K484*	probably null	Het
Nfasc	A	G	1: 132,601,983	S814P	probably damaging	Het
Nlrp4a	T	C	7: 26,462,516	V863A	probably benign	Het
Nos1	C	T	5: 117,867,883	P223S	probably benign	Het
Nr2f2	G	C	7: 70,360,175	P52R	probably damaging	Het
Olfr1440	A	T	19: 12,394,963	E233D	probably benign	Het
Olfr155	T	A	4: 43,854,512	S68T	probably damaging	Het
Olfr228	A	G	2: 86,483,386	S119P	possibly damaging	Het
Osbpl5	T	C	7: 143,741,669		probably null	Het
Otog	C	A	7: 46,264,032		probably null	Het
Pacs1	A	T	19: 5,156,374	I261N	possibly damaging	Het
Pbx1	G	A	1: 168,203,482	T189I	possibly damaging	Het
Pcnx	T	C	12: 81,947,018	I908T	possibly damaging	Het
Pdxdc1	A	T	16: 13,879,445	W124R	probably damaging	Het
Phex	C	A	X: 157,186,218	D587Y	probably damaging	Het
Plcb3	A	T	19: 6,962,995	D435E	probably benign	Het
Plce1	A	C	19: 38,728,886	K1373T	probably damaging	Het
Prkcd	G	A	14: 30,602,088	A311V	probably damaging	Het
Ptpn3	A	T	4: 57,232,374	S421T	probably benign	Het
Ptprs	T	C	17: 56,436,087		probably null	Het
Qrich1	A	G	9: 108,534,134	D286G	probably damaging	Het
Rcc1	C	A	4: 132,332,915	G393V	probably damaging	Het
Reln	T	C	5: 22,106,045	N290S	probably benign	Het
Rgl1	T	C	1: 152,554,424		probably benign	Het
Rhpn1	C	T	15: 75,714,122	T628I	probably benign	Het
Rilp	A	G	11: 75,510,921	R176G	probably benign	Het
Riok3	C	T	18: 12,155,227	A487V	probably benign	Het
Rnf224	T	C	2: 25,236,207	T45A	probably damaging	Het
Rpa1	A	G	11: 75,328,687	V137A	probably benign	Het
Rps6ka1	C	A	4: 133,848,531	Q693H	probably benign	Het
Scn2a	G	T	2: 65,735,774	V1381F	probably benign	Het
Scp2	T	A	4: 108,098,078	H112L	probably benign	Het
Sdk1	T	C	5: 141,998,747	W696R	probably damaging	Het
Slc26a7	C	A	4: 14,532,651	V408F	probably damaging	Het
Slc28a2	T	A	2: 122,454,527	I332N	probably benign	Het
Slc37a3	A	G	6: 39,337,238	V480A	probably benign	Het
Slc45a4	T	A	15: 73,581,906	E674D	probably benign	Het
Smpd3	T	C	8: 106,265,156	E255G	probably damaging	Het
Snx29	C	T	16: 11,660,553	R658W	probably damaging	Het
Sppl2a	A	T	2: 126,920,336	M275K	probably benign	Het
Stac	T	C	9: 111,635,021	N59S	probably damaging	Het
Stk25	A	T	1: 93,627,060	L131Q	probably damaging	Het
Tep1	C	T	14: 50,863,029		probably benign	Het
Thbs1	C	A	2: 118,114,393	N229K	probably damaging	Het
Tmx2	A	T	2: 84,675,842	H89Q	probably damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Tradd	T	C	8: 105,259,292	N209S	possibly damaging	Het
Trappc3l	A	T	10: 34,098,932	R119*	probably null	Het
Trmt1l	G	A	1: 151,457,454		probably benign	Het
Ublcp1	G	T	11: 44,458,277	Y243*	probably null	Het
Uhrf1bp1	T	A	17: 27,895,870		probably benign	Het
Usp24	C	A	4: 106,414,404	C2158*	probably null	Het
Usp34	A	T	11: 23,433,206	K2088N	probably damaging	Het
Vmn1r53	G	C	6: 90,223,943	S133C	probably damaging	Het
Vmn2r52	A	G	7: 10,159,400	V604A	probably damaging	Het
Vmn2r93	A	G	17: 18,304,799	K240E	probably benign	Het
Wdr13	T	G	X: 8,128,045	D242A	probably damaging	Het
Wwp1	C	T	4: 19,641,734		probably null	Het
Zan	G	A	5: 137,398,362	H4311Y	unknown	Het
Zc3h12c	C	A	9: 52,144,083	R123L	possibly damaging	Het
Zfp125	A	T	12: 20,900,561		noncoding transcript	Het
Zfp318	C	T	17: 46,396,813	P266S	probably benign	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGGCAGAGATTTGCACCCCAGAC -3'
(R):5'- CCAAGGGATTATTACAGGGAGCAGC -3'

Sequencing Primer
(F):5'- AGGTAACTGCAGGCGTTT -3'
(R):5'- AACGTTTGCTGCCACAGG -3'

Posted On

2014-07-08