Incidental Mutation 'R0468:Slc7a11'
ID212513
Institutional Source Beutler Lab
Gene Symbol Slc7a11
Ensembl Gene ENSMUSG00000027737
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 11
Synonymssut, System x, x, 9930009M05Rik, xCT
MMRRC Submission 038668-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0468 (G1)
Quality Score56
Status Validated
Chromosome3
Chromosomal Location49892526-50443614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50384051 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 303 (V303A)
Ref Sequence ENSEMBL: ENSMUSP00000141988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029297] [ENSMUST00000194462]
Predicted Effect probably damaging
Transcript: ENSMUST00000029297
AA Change: V303A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029297
Gene: ENSMUSG00000027737
AA Change: V303A

DomainStartEndE-ValueType
Pfam:AA_permease_2 44 469 3.3e-61 PFAM
Pfam:AA_permease 49 478 1.1e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194462
AA Change: V303A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141988
Gene: ENSMUSG00000027737
AA Change: V303A

DomainStartEndE-ValueType
Pfam:AA_permease_2 44 469 1.1e-60 PFAM
Pfam:AA_permease 49 479 2e-32 PFAM
Meta Mutation Damage Score 0.7084 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a heteromeric, sodium-independent, anionic amino acid transport system that is highly specific for cysteine and glutamate. In this system, designated Xc(-), the anionic form of cysteine is transported in exchange for glutamate. This protein has been identified as the predominant mediator of Kaposi sarcoma-associated herpesvirus fusion and entry permissiveness into cells. Also, increased expression of this gene in primary gliomas (compared to normal brain tissue) was associated with increased glutamate secretion via the XCT channels, resulting in neuronal cell death. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutant mice show a reduction in yellow pigment resulting in dilution of agouti; only pinna hairs are affected in nonagouti mice. Mice homozygous for an ENU-induced allele exhibit decreased survival of LPS-induced macrophages and increased incidence of chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,193,310 H1298R possibly damaging Het
5530400C23Rik T C 6: 133,294,458 L155P probably benign Het
6820408C15Rik A T 2: 152,441,266 R283S probably benign Het
Aldh1l2 T A 10: 83,518,678 E104D probably benign Het
Anxa3 T C 5: 96,811,099 V22A probably benign Het
Bcl7b T C 5: 135,180,883 F188L probably benign Het
Brinp1 T A 4: 68,762,776 I506F probably damaging Het
Bsdc1 T C 4: 129,461,718 probably benign Het
Ccdc180 T C 4: 45,923,271 I1075T possibly damaging Het
Cep162 A G 9: 87,193,697 L1294P probably damaging Het
Cltc G A 11: 86,704,626 probably benign Het
Col11a1 T C 3: 114,217,058 probably benign Het
Col14a1 A T 15: 55,388,646 Y566F unknown Het
Dhx29 A G 13: 112,963,277 Q1148R probably benign Het
Ehbp1 A G 11: 22,169,184 probably benign Het
Ehd3 A G 17: 73,805,379 H46R probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Gm4553 C A 7: 142,165,625 C22F unknown Het
Hibadh C T 6: 52,557,770 probably benign Het
Hspg2 G A 4: 137,533,529 C1613Y probably damaging Het
Hydin G T 8: 110,413,223 C708F possibly damaging Het
Ifi208 A T 1: 173,683,481 M401L probably benign Het
Igsf8 G A 1: 172,318,796 V454M probably damaging Het
Irx4 G T 13: 73,266,720 probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kcnn2 C T 18: 45,559,471 T38M possibly damaging Het
L3mbtl3 C T 10: 26,327,732 R400H unknown Het
Lrp6 T C 6: 134,485,661 T679A possibly damaging Het
Map9 T C 3: 82,374,203 probably null Het
Men1 T A 19: 6,336,923 V5E probably null Het
Mettl14 T C 3: 123,371,412 D93G probably damaging Het
Neb G T 2: 52,211,556 R4601S probably damaging Het
Nell1 A G 7: 50,228,846 T272A probably damaging Het
Olfr1115 A T 2: 87,252,255 N106I probably benign Het
Olfr319 A T 11: 58,701,793 I31F probably damaging Het
Pclo C A 5: 14,677,288 probably benign Het
Pdia5 A G 16: 35,397,507 L502P probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plxna4 C A 6: 32,215,246 C803F probably damaging Het
Pmfbp1 A G 8: 109,513,968 probably null Het
Ptgs1 A G 2: 36,249,193 Y468C probably damaging Het
Pxdn G T 12: 29,994,486 G488W probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Sec31b T A 19: 44,518,508 probably benign Het
Shank3 G A 15: 89,549,275 V1333I probably benign Het
Slamf1 A G 1: 171,792,371 probably benign Het
Slc23a3 T A 1: 75,133,230 Q131L possibly damaging Het
Slc7a13 T A 4: 19,841,500 V449D probably benign Het
Srp68 A T 11: 116,248,764 I453K probably damaging Het
Steap3 A T 1: 120,234,300 V414D probably damaging Het
Tagln2 A G 1: 172,506,221 N131D probably benign Het
Tmem132d T C 5: 128,269,203 Y85C probably damaging Het
Vcam1 A T 3: 116,115,946 Y577* probably null Het
Vmn1r214 A G 13: 23,035,253 T306A probably benign Het
Zfyve1 A T 12: 83,555,274 probably benign Het
Zgrf1 T A 3: 127,562,041 N305K possibly damaging Het
Other mutations in Slc7a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Slc7a11 APN 3 50427687 missense probably benign 0.06
IGL00990:Slc7a11 APN 3 50379069 missense probably damaging 1.00
IGL01755:Slc7a11 APN 3 50424067 missense probably benign 0.39
IGL03105:Slc7a11 APN 3 50372339 missense possibly damaging 0.67
IGL03141:Slc7a11 APN 3 50381885 missense possibly damaging 0.66
R0735:Slc7a11 UTSW 3 50424096 missense probably benign 0.00
R1363:Slc7a11 UTSW 3 50424051 missense probably damaging 1.00
R1466:Slc7a11 UTSW 3 50381073 splice site probably null
R1466:Slc7a11 UTSW 3 50381073 splice site probably null
R1554:Slc7a11 UTSW 3 50381896 missense probably damaging 1.00
R1734:Slc7a11 UTSW 3 50372346 nonsense probably null
R2128:Slc7a11 UTSW 3 50384109 missense probably damaging 0.97
R2504:Slc7a11 UTSW 3 50377746 splice site probably null
R3116:Slc7a11 UTSW 3 50384139 missense probably benign 0.13
R3981:Slc7a11 UTSW 3 50427774 missense probably benign
R4479:Slc7a11 UTSW 3 50417963 intron probably benign
R5117:Slc7a11 UTSW 3 50379150 missense probably damaging 0.99
R5586:Slc7a11 UTSW 3 50443083 missense possibly damaging 0.95
R5621:Slc7a11 UTSW 3 50438875 missense probably damaging 1.00
R5689:Slc7a11 UTSW 3 50372331 missense probably benign 0.01
R5692:Slc7a11 UTSW 3 50372331 missense probably benign 0.01
R5965:Slc7a11 UTSW 3 50379144 missense probably benign 0.00
R6338:Slc7a11 UTSW 3 50384043 critical splice donor site probably null
R7177:Slc7a11 UTSW 3 50443231 missense probably benign 0.00
R7337:Slc7a11 UTSW 3 50442999 missense possibly damaging 0.50
R7634:Slc7a11 UTSW 3 50424037 splice site probably null
R7756:Slc7a11 UTSW 3 50372360 missense probably benign
R7758:Slc7a11 UTSW 3 50372360 missense probably benign
R7821:Slc7a11 UTSW 3 50381027 missense probably damaging 1.00
R8112:Slc7a11 UTSW 3 50417991 missense possibly damaging 0.92
R8218:Slc7a11 UTSW 3 50424052 missense probably damaging 1.00
R8255:Slc7a11 UTSW 3 50427728 missense probably damaging 0.98
R8318:Slc7a11 UTSW 3 50417986 critical splice donor site probably null
R8396:Slc7a11 UTSW 3 50384129 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- CGATTTGCATTCAGCAACTCCACC -3'
(R):5'- TGTGCCAACAAAGCCCTCAGTTATG -3'

Sequencing Primer
(F):5'- GGGAAGATATTCCCTCTCTGTAAGAC -3'
(R):5'- TGGCGACATCCATCCCTG -3'
Posted On2014-07-08