Incidental Mutation 'R0124:Cyp2c37'
ID 21252
Institutional Source Beutler Lab
Gene Symbol Cyp2c37
Ensembl Gene ENSMUSG00000042248
Gene Name cytochrome P450, family 2. subfamily c, polypeptide 37
Synonyms
MMRRC Submission 038409-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R0124 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 19
Chromosomal Location 39980868-40000687 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 39982546 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 128 (L128P)
Ref Sequence ENSEMBL: ENSMUSP00000045362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049178]
AlphaFold P56654
Predicted Effect probably damaging
Transcript: ENSMUST00000049178
AA Change: L128P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045362
Gene: ENSMUSG00000042248
AA Change: L128P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:p450 30 487 5e-160 PFAM
Meta Mutation Damage Score 0.9095 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.7%
  • 20x: 89.8%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,138,656 (GRCm39) T194A probably benign Het
Afap1 C T 5: 36,102,553 (GRCm39) P82S probably damaging Het
Ankrd28 A G 14: 31,449,698 (GRCm39) Y481H probably damaging Het
Arid1b C T 17: 5,389,605 (GRCm39) T1717I probably damaging Het
Atad2b A G 12: 5,002,676 (GRCm39) K348R probably benign Het
Bcl3 C T 7: 19,543,576 (GRCm39) V5M probably damaging Het
C2cd3 A G 7: 100,118,725 (GRCm39) E2321G probably benign Het
Casq1 C T 1: 172,037,992 (GRCm39) V380M probably damaging Het
Cd209e T A 8: 3,901,274 (GRCm39) T127S probably benign Het
Cdh23 G T 10: 60,143,835 (GRCm39) Y2921* probably null Het
Cdh6 A G 15: 13,034,410 (GRCm39) L750P probably damaging Het
Cdk12 T C 11: 98,102,073 (GRCm39) probably benign Het
Ces5a T C 8: 94,255,183 (GRCm39) E170G probably damaging Het
Clec4f A G 6: 83,629,335 (GRCm39) probably null Het
Col19a1 T C 1: 24,565,539 (GRCm39) N264S unknown Het
Col2a1 T A 15: 97,896,743 (GRCm39) I43F unknown Het
Col4a2 A G 8: 11,458,871 (GRCm39) probably benign Het
Csmd3 T A 15: 47,454,112 (GRCm39) D3578V probably damaging Het
Dennd2b A G 7: 109,141,718 (GRCm39) S132P possibly damaging Het
Dysf A G 6: 84,042,084 (GRCm39) probably benign Het
Eml1 T C 12: 108,472,867 (GRCm39) V225A probably benign Het
Eml1 A G 12: 108,475,437 (GRCm39) Y256C probably damaging Het
Epb41l5 T A 1: 119,561,370 (GRCm39) K64* probably null Het
Fat2 A G 11: 55,174,504 (GRCm39) F2070L probably damaging Het
Fbxw18 G T 9: 109,520,583 (GRCm39) H259N probably benign Het
Gm10764 A T 10: 87,126,610 (GRCm39) T6S unknown Het
Gm14412 A G 2: 177,007,705 (GRCm39) probably benign Het
Heatr5b A T 17: 79,133,646 (GRCm39) probably benign Het
Hid1 T C 11: 115,247,649 (GRCm39) T250A probably damaging Het
Hnf4g A G 3: 3,708,142 (GRCm39) probably benign Het
Ifnar1 C T 16: 91,296,425 (GRCm39) Q309* probably null Het
Lrriq1 C T 10: 103,006,281 (GRCm39) probably null Het
Map3k13 A G 16: 21,722,506 (GRCm39) T223A possibly damaging Het
Matn2 C T 15: 34,426,297 (GRCm39) probably benign Het
Myo6 A G 9: 80,215,056 (GRCm39) E1253G probably damaging Het
Nomo1 G T 7: 45,732,652 (GRCm39) probably benign Het
Or1ak2 A T 2: 36,827,268 (GRCm39) I46F possibly damaging Het
Or4c116 A T 2: 88,942,088 (GRCm39) I256K possibly damaging Het
Or8a1b A G 9: 37,622,759 (GRCm39) V272A possibly damaging Het
Papolg C T 11: 23,817,535 (GRCm39) A582T probably benign Het
Plekhm3 C T 1: 64,960,910 (GRCm39) E449K probably damaging Het
Pole T G 5: 110,451,858 (GRCm39) M900R probably damaging Het
Ppp1cb T A 5: 32,640,822 (GRCm39) probably benign Het
Pramel17 A G 4: 101,692,570 (GRCm39) *477Q probably null Het
Pros1 A G 16: 62,734,309 (GRCm39) T372A possibly damaging Het
Scara3 A T 14: 66,168,670 (GRCm39) S316T probably benign Het
Stau2 C T 1: 16,533,352 (GRCm39) A61T probably damaging Het
Stx3 T C 19: 11,769,163 (GRCm39) E54G possibly damaging Het
Sun1 T C 5: 139,232,434 (GRCm39) probably benign Het
Swt1 A T 1: 151,267,280 (GRCm39) C634S probably damaging Het
Syt6 A G 3: 103,494,842 (GRCm39) Y269C probably damaging Het
Tfap2a G A 13: 40,870,887 (GRCm39) probably benign Het
Tmx4 A T 2: 134,481,640 (GRCm39) probably null Het
Ttc39d T C 17: 80,524,375 (GRCm39) C345R probably damaging Het
Vmn1r27 T C 6: 58,192,233 (GRCm39) Y257C probably damaging Het
Vmn2r27 T A 6: 124,208,578 (GRCm39) T56S probably benign Het
Vps13b T C 15: 35,576,674 (GRCm39) probably null Het
Wdr17 A G 8: 55,088,526 (GRCm39) S1175P probably damaging Het
Wsb2 T C 5: 117,501,823 (GRCm39) F63L probably benign Het
Zfp142 A G 1: 74,607,782 (GRCm39) Y1561H probably damaging Het
Other mutations in Cyp2c37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Cyp2c37 APN 19 39,990,441 (GRCm39) missense probably benign 0.00
IGL01307:Cyp2c37 APN 19 39,981,023 (GRCm39) missense probably benign 0.00
IGL01959:Cyp2c37 APN 19 39,984,277 (GRCm39) nonsense probably null
IGL02580:Cyp2c37 APN 19 39,982,942 (GRCm39) missense probably damaging 1.00
IGL02611:Cyp2c37 APN 19 39,982,309 (GRCm39) missense probably benign 0.00
R0391:Cyp2c37 UTSW 19 39,982,950 (GRCm39) missense probably damaging 1.00
R0420:Cyp2c37 UTSW 19 39,984,238 (GRCm39) missense probably benign 0.00
R0782:Cyp2c37 UTSW 19 39,982,269 (GRCm39) missense probably benign 0.00
R1413:Cyp2c37 UTSW 19 39,982,542 (GRCm39) missense probably benign 0.21
R1637:Cyp2c37 UTSW 19 39,990,426 (GRCm39) nonsense probably null
R1688:Cyp2c37 UTSW 19 39,982,887 (GRCm39) splice site probably null
R2258:Cyp2c37 UTSW 19 39,984,303 (GRCm39) missense possibly damaging 0.49
R4353:Cyp2c37 UTSW 19 39,988,989 (GRCm39) missense possibly damaging 0.66
R4640:Cyp2c37 UTSW 19 40,000,276 (GRCm39) missense possibly damaging 0.67
R4965:Cyp2c37 UTSW 19 40,000,206 (GRCm39) missense possibly damaging 0.79
R5053:Cyp2c37 UTSW 19 39,990,331 (GRCm39) missense probably benign 0.00
R5645:Cyp2c37 UTSW 19 39,982,596 (GRCm39) missense probably benign 0.04
R5847:Cyp2c37 UTSW 19 40,000,176 (GRCm39) missense probably damaging 0.98
R6487:Cyp2c37 UTSW 19 39,983,025 (GRCm39) missense probably benign
R6631:Cyp2c37 UTSW 19 39,998,287 (GRCm39) missense probably damaging 1.00
R7062:Cyp2c37 UTSW 19 39,983,990 (GRCm39) splice site probably null
R7937:Cyp2c37 UTSW 19 39,982,202 (GRCm39) missense probably damaging 1.00
R9640:Cyp2c37 UTSW 19 40,000,180 (GRCm39) missense probably benign 0.01
R9779:Cyp2c37 UTSW 19 39,998,323 (GRCm39) missense probably benign 0.09
R9784:Cyp2c37 UTSW 19 39,988,943 (GRCm39) missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ACTCTGCTCCTGAGGCACAGTTTG -3'
(R):5'- TGCAACCAAGGGCTGCTCAGAATC -3'

Sequencing Primer
(F):5'- GGGATTCTATGGCTACAACCAG -3'
(R):5'- TAGAAGACACCTTGCCCTTG -3'
Posted On 2013-04-11