Incidental Mutation 'R0022:Pik3r2'
ID212523
Institutional Source Beutler Lab
Gene Symbol Pik3r2
Ensembl Gene ENSMUSG00000031834
Gene Namephosphoinositide-3-kinase regulatory subunit 2
Synonymsp85beta
MMRRC Submission 038317-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0022 (G1)
Quality Score48
Status Validated
Chromosome8
Chromosomal Location70768176-70776713 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70770901 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 346 (F346S)
Ref Sequence ENSEMBL: ENSMUSP00000034296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000143785]
PDB Structure CRYSTAL STRUCTURE OF P110BETA IN COMPLEX WITH ICSH2 OF P85BETA AND THE DRUG GDC-0941 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000034296
AA Change: F346S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834
AA Change: F346S

DomainStartEndE-ValueType
SH3 7 79 4e-7 SMART
RhoGAP 122 286 2.36e-18 SMART
low complexity region 291 311 N/A INTRINSIC
SH2 322 405 4.51e-26 SMART
Pfam:PI3K_P85_iSH2 422 590 1.7e-64 PFAM
SH2 614 696 9.96e-28 SMART
low complexity region 713 718 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000034299
SMART Domains Protein: ENSMUSP00000034299
Gene: ENSMUSG00000031838

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:GILT 60 163 4e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142370
Predicted Effect probably benign
Transcript: ENSMUST00000143785
SMART Domains Protein: ENSMUSP00000122065
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
Blast:RhoGAP 1 30 1e-8 BLAST
Pfam:SH2 33 70 4.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146707
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152545
Predicted Effect probably benign
Transcript: ENSMUST00000154685
SMART Domains Protein: ENSMUSP00000121463
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
PDB:2XS6|A 43 84 3e-11 PDB
SCOP:d1pbwa_ 47 79 6e-9 SMART
Blast:RhoGAP 58 84 4e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222087
Meta Mutation Damage Score 0.9749 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase (PI3K) is a lipid kinase that phosphorylates phosphatidylinositol and similar compounds, creating second messengers important in growth signaling pathways. PI3K functions as a heterodimer of a regulatory and a catalytic subunit. The protein encoded by this gene is a regulatory component of PI3K. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene have lower blood glucose levels both when fed and after fasting. Insulin sensitivity is improved as well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C T 1: 37,628,245 R240Q probably damaging Het
2310035C23Rik T A 1: 105,691,902 probably benign Het
Agl A T 3: 116,793,836 probably null Het
Arhgap29 G A 3: 121,988,937 V91I possibly damaging Het
Aste1 T A 9: 105,396,624 L21* probably null Het
Bpifb5 A T 2: 154,230,348 D325V probably damaging Het
Btbd10 G A 7: 113,325,781 Q287* probably null Het
Cdc20 T A 4: 118,435,489 H354L probably damaging Het
Cdhr3 G A 12: 33,082,264 T120I probably damaging Het
Col5a2 G A 1: 45,383,683 R1125* probably null Het
Col9a3 A G 2: 180,619,756 D613G probably damaging Het
Coro7 C T 16: 4,633,304 R507H probably benign Het
Crebbp A T 16: 4,085,228 V2049E probably damaging Het
Cryga T C 1: 65,103,223 I4V probably damaging Het
D930020B18Rik A G 10: 121,671,770 T138A probably damaging Het
Dclre1b G T 3: 103,803,148 H482Q probably benign Het
Dpy19l2 A G 9: 24,696,124 S14P probably benign Het
Elavl3 C A 9: 22,036,871 probably benign Het
Ephb6 T C 6: 41,614,569 V220A probably damaging Het
Exoc7 A T 11: 116,297,582 I297N possibly damaging Het
Gdpd4 A T 7: 97,982,875 N332Y probably damaging Het
Ggct C A 6: 54,985,902 E175* probably null Het
Gm5316 T C 6: 122,900,395 noncoding transcript Het
Hoxa7 T C 6: 52,217,383 N8S probably damaging Het
Ifi208 A G 1: 173,683,046 T256A possibly damaging Het
Il12rb2 A G 6: 67,298,919 F630S probably damaging Het
Kit A G 5: 75,622,997 N378S probably benign Het
Lmntd1 T A 6: 145,429,990 Y74F probably benign Het
Lrp1b A T 2: 40,998,038 probably benign Het
Ltbp1 T A 17: 75,364,360 V1194D probably damaging Het
Mc5r T G 18: 68,338,782 S71A probably benign Het
Mcm7 T C 5: 138,164,719 *390W probably null Het
Myo18a T C 11: 77,843,233 probably null Het
Naa25 C A 5: 121,417,976 L276M probably damaging Het
Nlrp1a T G 11: 71,123,381 T348P probably damaging Het
Nlrp1b T G 11: 71,161,929 K888T possibly damaging Het
Olfr1276 A G 2: 111,257,649 Y178C probably benign Het
Pabpc6 A T 17: 9,669,216 N135K probably benign Het
Pdzd2 G A 15: 12,371,605 A2568V possibly damaging Het
Pkd1 T C 17: 24,594,819 W4086R probably damaging Het
Plekhb2 G A 1: 34,866,239 probably benign Het
Plxnb2 A G 15: 89,163,276 probably null Het
Pmfbp1 C T 8: 109,525,407 R395W probably damaging Het
Pnldc1 A G 17: 12,890,119 Y497H probably damaging Het
Ppp1ca T G 19: 4,194,581 V213G possibly damaging Het
Rapgef2 G A 3: 79,087,900 R814C probably damaging Het
Rnasel A T 1: 153,760,775 I634F probably damaging Het
Rnf157 A T 11: 116,349,450 probably benign Het
Ryr3 A G 2: 112,640,666 S4567P probably damaging Het
Smcr8 T A 11: 60,780,359 W778R probably damaging Het
Stat1 T A 1: 52,140,630 L333Q probably damaging Het
Strc A G 2: 121,368,393 L1391P probably damaging Het
Tek G A 4: 94,837,272 V592M probably damaging Het
Top1 A C 2: 160,702,799 K278N possibly damaging Het
Utrn C T 10: 12,709,956 probably benign Het
Wdr7 T C 18: 63,777,634 I699T probably damaging Het
Zfp30 A G 7: 29,792,435 E119G possibly damaging Het
Other mutations in Pik3r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Pik3r2 APN 8 70770429 missense probably damaging 1.00
IGL01637:Pik3r2 APN 8 70772348 unclassified probably benign
IGL02514:Pik3r2 APN 8 70770592 missense probably benign 0.00
IGL03395:Pik3r2 APN 8 70772355 missense probably benign
kingfisher UTSW 8 70770901 missense probably damaging 1.00
R0022:Pik3r2 UTSW 8 70770901 missense probably damaging 1.00
R0448:Pik3r2 UTSW 8 70772044 unclassified probably benign
R1636:Pik3r2 UTSW 8 70771898 missense probably benign
R1662:Pik3r2 UTSW 8 70770606 missense probably damaging 1.00
R2114:Pik3r2 UTSW 8 70769385 missense probably benign 0.31
R2879:Pik3r2 UTSW 8 70772385 missense probably benign
R3830:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3852:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3859:Pik3r2 UTSW 8 70769986 missense probably damaging 1.00
R3967:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3968:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3969:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3970:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R4606:Pik3r2 UTSW 8 70772136 nonsense probably null
R4666:Pik3r2 UTSW 8 70768859 missense possibly damaging 0.93
R5481:Pik3r2 UTSW 8 70769764 missense probably benign 0.31
R6445:Pik3r2 UTSW 8 70772026 missense probably benign 0.01
R6578:Pik3r2 UTSW 8 70772639 missense probably benign 0.00
R6667:Pik3r2 UTSW 8 70769173 missense probably damaging 1.00
R6794:Pik3r2 UTSW 8 70770717 missense probably benign 0.43
R6863:Pik3r2 UTSW 8 70770414 missense probably damaging 1.00
R7378:Pik3r2 UTSW 8 70769381 missense probably benign 0.03
R7750:Pik3r2 UTSW 8 70770901 missense probably damaging 1.00
R7821:Pik3r2 UTSW 8 70769764 missense probably damaging 1.00
R8056:Pik3r2 UTSW 8 70772367 missense probably benign 0.14
R8237:Pik3r2 UTSW 8 70772150 missense probably benign 0.00
R8414:Pik3r2 UTSW 8 70770435 missense probably damaging 1.00
R8534:Pik3r2 UTSW 8 70774668 missense probably benign
R8781:Pik3r2 UTSW 8 70769402 missense possibly damaging 0.88
R8794:Pik3r2 UTSW 8 70771363 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGAGAAGCCATAGTGACCATCCC -3'
(R):5'- TTGCAGCGGCAGTATGCACTTG -3'

Sequencing Primer
(F):5'- CATCCCGGTGGAAGACTTTG -3'
(R):5'- TCGCTTCAGGATGCAGAG -3'
Posted On2014-07-08