Incidental Mutation 'R0022:Elavl3'
ID212524
Institutional Source Beutler Lab
Gene Symbol Elavl3
Ensembl Gene ENSMUSG00000003410
Gene NameELAV like RNA binding protein 3
Synonyms2600009P04Rik, Huc, mHuC
MMRRC Submission 038317-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.407) question?
Stock #R0022 (G1)
Quality Score52
Status Validated
Chromosome9
Chromosomal Location22015005-22052023 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 22036871 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003501] [ENSMUST00000215901]
Predicted Effect probably benign
Transcript: ENSMUST00000003501
SMART Domains Protein: ENSMUSP00000003501
Gene: ENSMUSG00000003410

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
RRM 40 113 9.99e-24 SMART
RRM 126 201 2.81e-18 SMART
low complexity region 266 283 N/A INTRINSIC
RRM 285 358 1.79e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213738
Predicted Effect probably benign
Transcript: ENSMUST00000215901
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A member of the ELAVL protein family, ELAV-like 3 is a neural-specific RNA-binding protein which contains three RNP-type RNA recognition motifs. The observation that ELAVL3 is one of several Hu antigens (neuronal-specific RNA-binding proteins) recognized by the anti-Hu serum antibody present in sera from patients with paraneoplastic encephalomyelitis and sensory neuronopathy (PEM/PSN) suggests it has a role in neurogenesis. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit strain-specific preweaning lethality, abnormal cortical hypersynchronization and non-convulsive electropgraphic seizure. Mice heterozygous for the allele exhibit abnormal brain wave pattern and spike wave discharge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C T 1: 37,628,245 R240Q probably damaging Het
2310035C23Rik T A 1: 105,691,902 probably benign Het
Agl A T 3: 116,793,836 probably null Het
Arhgap29 G A 3: 121,988,937 V91I possibly damaging Het
Aste1 T A 9: 105,396,624 L21* probably null Het
Bpifb5 A T 2: 154,230,348 D325V probably damaging Het
Btbd10 G A 7: 113,325,781 Q287* probably null Het
Cdc20 T A 4: 118,435,489 H354L probably damaging Het
Cdhr3 G A 12: 33,082,264 T120I probably damaging Het
Col5a2 G A 1: 45,383,683 R1125* probably null Het
Col9a3 A G 2: 180,619,756 D613G probably damaging Het
Coro7 C T 16: 4,633,304 R507H probably benign Het
Crebbp A T 16: 4,085,228 V2049E probably damaging Het
Cryga T C 1: 65,103,223 I4V probably damaging Het
D930020B18Rik A G 10: 121,671,770 T138A probably damaging Het
Dclre1b G T 3: 103,803,148 H482Q probably benign Het
Dpy19l2 A G 9: 24,696,124 S14P probably benign Het
Ephb6 T C 6: 41,614,569 V220A probably damaging Het
Exoc7 A T 11: 116,297,582 I297N possibly damaging Het
Gdpd4 A T 7: 97,982,875 N332Y probably damaging Het
Ggct C A 6: 54,985,902 E175* probably null Het
Gm5316 T C 6: 122,900,395 noncoding transcript Het
Hoxa7 T C 6: 52,217,383 N8S probably damaging Het
Ifi208 A G 1: 173,683,046 T256A possibly damaging Het
Il12rb2 A G 6: 67,298,919 F630S probably damaging Het
Kit A G 5: 75,622,997 N378S probably benign Het
Lmntd1 T A 6: 145,429,990 Y74F probably benign Het
Lrp1b A T 2: 40,998,038 probably benign Het
Ltbp1 T A 17: 75,364,360 V1194D probably damaging Het
Mc5r T G 18: 68,338,782 S71A probably benign Het
Mcm7 T C 5: 138,164,719 *390W probably null Het
Myo18a T C 11: 77,843,233 probably null Het
Naa25 C A 5: 121,417,976 L276M probably damaging Het
Nlrp1a T G 11: 71,123,381 T348P probably damaging Het
Nlrp1b T G 11: 71,161,929 K888T possibly damaging Het
Olfr1276 A G 2: 111,257,649 Y178C probably benign Het
Pabpc6 A T 17: 9,669,216 N135K probably benign Het
Pdzd2 G A 15: 12,371,605 A2568V possibly damaging Het
Pik3r2 A G 8: 70,770,901 F346S probably damaging Het
Pkd1 T C 17: 24,594,819 W4086R probably damaging Het
Plekhb2 G A 1: 34,866,239 probably benign Het
Plxnb2 A G 15: 89,163,276 probably null Het
Pmfbp1 C T 8: 109,525,407 R395W probably damaging Het
Pnldc1 A G 17: 12,890,119 Y497H probably damaging Het
Ppp1ca T G 19: 4,194,581 V213G possibly damaging Het
Rapgef2 G A 3: 79,087,900 R814C probably damaging Het
Rnasel A T 1: 153,760,775 I634F probably damaging Het
Rnf157 A T 11: 116,349,450 probably benign Het
Ryr3 A G 2: 112,640,666 S4567P probably damaging Het
Smcr8 T A 11: 60,780,359 W778R probably damaging Het
Stat1 T A 1: 52,140,630 L333Q probably damaging Het
Strc A G 2: 121,368,393 L1391P probably damaging Het
Tek G A 4: 94,837,272 V592M probably damaging Het
Top1 A C 2: 160,702,799 K278N possibly damaging Het
Utrn C T 10: 12,709,956 probably benign Het
Wdr7 T C 18: 63,777,634 I699T probably damaging Het
Zfp30 A G 7: 29,792,435 E119G possibly damaging Het
Other mutations in Elavl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Elavl3 APN 9 22036718 missense probably damaging 1.00
IGL02740:Elavl3 APN 9 22036379 missense probably benign 0.06
IGL03011:Elavl3 APN 9 22036316 missense probably damaging 1.00
IGL03211:Elavl3 APN 9 22018678 missense probably damaging 1.00
R0105:Elavl3 UTSW 9 22036833 missense possibly damaging 0.84
R0850:Elavl3 UTSW 9 22036763 missense probably damaging 0.96
R1496:Elavl3 UTSW 9 22026165 splice site probably benign
R1499:Elavl3 UTSW 9 22018579 missense probably damaging 0.97
R3500:Elavl3 UTSW 9 22018744 missense probably damaging 1.00
R3714:Elavl3 UTSW 9 22018599 missense probably benign 0.11
R3715:Elavl3 UTSW 9 22018599 missense probably benign 0.11
R3937:Elavl3 UTSW 9 22018744 missense probably damaging 1.00
R3938:Elavl3 UTSW 9 22018744 missense probably damaging 1.00
R4791:Elavl3 UTSW 9 22024678 missense probably damaging 0.99
R4856:Elavl3 UTSW 9 22026318 missense possibly damaging 0.64
R4886:Elavl3 UTSW 9 22026318 missense possibly damaging 0.64
R4962:Elavl3 UTSW 9 22036811 missense probably benign 0.06
R5526:Elavl3 UTSW 9 22036326 missense probably benign
R5643:Elavl3 UTSW 9 22018733 missense probably benign 0.12
R6593:Elavl3 UTSW 9 22018547 missense possibly damaging 0.58
R7102:Elavl3 UTSW 9 22018729 missense possibly damaging 0.72
R7897:Elavl3 UTSW 9 22018550 missense probably damaging 1.00
R7941:Elavl3 UTSW 9 22036316 missense possibly damaging 0.94
R8710:Elavl3 UTSW 9 22026553 missense not run
Predicted Primers PCR Primer
(F):5'- TGAACTCGTCCTGTGTCATGTTCTG -3'
(R):5'- ACACCTTTACTGCTGAGCTGTCG -3'

Sequencing Primer
(F):5'- GGGGTAGGTAGTTGACGATGAG -3'
(R):5'- tcaggaggcagaggcag -3'
Posted On2014-07-08