Incidental Mutation 'R0022:Smcr8'
ID212526
Institutional Source Beutler Lab
Gene Symbol Smcr8
Ensembl Gene ENSMUSG00000049323
Gene NameSmith-Magenis syndrome chromosome region, candidate 8 homolog (human)
Synonyms2310076G09Rik, D030073L15Rik
MMRRC Submission 038317-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0022 (G1)
Quality Score49
Status Validated
Chromosome11
Chromosomal Location60777524-60788287 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 60780359 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 778 (W778R)
Ref Sequence ENSEMBL: ENSMUSP00000099728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002891] [ENSMUST00000056907] [ENSMUST00000102667] [ENSMUST00000102668] [ENSMUST00000117743] [ENSMUST00000120417] [ENSMUST00000130068]
Predicted Effect probably benign
Transcript: ENSMUST00000002891
SMART Domains Protein: ENSMUSP00000002891
Gene: ENSMUSG00000002814

DomainStartEndE-ValueType
TOPRIM 35 169 5.04e-24 SMART
TOP1Bc 172 269 4.99e-37 SMART
TOP1Ac 315 569 1.47e-107 SMART
Pfam:zf-C4_Topoisom 655 694 1.7e-15 PFAM
Pfam:zf-GRF 813 854 9.7e-23 PFAM
low complexity region 884 896 N/A INTRINSIC
Pfam:zf-GRF 897 941 7.9e-24 PFAM
ZnF_C2HC 985 1001 7.06e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000056907
AA Change: W778R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055926
Gene: ENSMUSG00000049323
AA Change: W778R

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
Pfam:Folliculin 78 262 5e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102667
AA Change: W778R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099728
Gene: ENSMUSG00000049323
AA Change: W778R

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
Pfam:Folliculin 87 255 8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102668
SMART Domains Protein: ENSMUSP00000099729
Gene: ENSMUSG00000002814

DomainStartEndE-ValueType
TOPRIM 35 169 5.04e-24 SMART
TOP1Bc 172 269 4.99e-37 SMART
TOP1Ac 315 569 1.47e-107 SMART
Pfam:zf-C4_Topoisom 655 694 5.9e-16 PFAM
Pfam:zf-GRF 813 854 2.6e-21 PFAM
low complexity region 884 896 N/A INTRINSIC
Pfam:zf-GRF 897 941 4.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117743
SMART Domains Protein: ENSMUSP00000113057
Gene: ENSMUSG00000002814

DomainStartEndE-ValueType
TOPRIM 10 144 5.04e-24 SMART
TOP1Bc 147 244 4.99e-37 SMART
TOP1Ac 290 544 1.47e-107 SMART
Pfam:zf-C4_Topoisom 630 669 4.6e-16 PFAM
ZnF_C2HC 755 771 7.06e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120417
SMART Domains Protein: ENSMUSP00000113653
Gene: ENSMUSG00000002814

DomainStartEndE-ValueType
TOPRIM 10 144 5.04e-24 SMART
TOP1Bc 147 244 4.99e-37 SMART
TOP1Ac 290 544 1.47e-107 SMART
Pfam:zf-C4_Topoisom 630 666 1.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130068
SMART Domains Protein: ENSMUSP00000115727
Gene: ENSMUSG00000002814

DomainStartEndE-ValueType
PDB:4CGY|A 1 85 2e-48 PDB
SCOP:d1gkub3 5 85 7e-12 SMART
Blast:TOPRIM 10 85 7e-50 BLAST
Meta Mutation Damage Score 0.224 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency 100% (68/68)
MGI Phenotype PHENOTYPE: Mouse embryonic fibroblasts homozygous for a knock-out allele show impaired autophagy induction, a reduced autophagic flux, and abnormal expression of lysosomal enzymes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C T 1: 37,628,245 R240Q probably damaging Het
2310035C23Rik T A 1: 105,691,902 probably benign Het
Agl A T 3: 116,793,836 probably null Het
Arhgap29 G A 3: 121,988,937 V91I possibly damaging Het
Aste1 T A 9: 105,396,624 L21* probably null Het
Bpifb5 A T 2: 154,230,348 D325V probably damaging Het
Btbd10 G A 7: 113,325,781 Q287* probably null Het
Cdc20 T A 4: 118,435,489 H354L probably damaging Het
Cdhr3 G A 12: 33,082,264 T120I probably damaging Het
Col5a2 G A 1: 45,383,683 R1125* probably null Het
Col9a3 A G 2: 180,619,756 D613G probably damaging Het
Coro7 C T 16: 4,633,304 R507H probably benign Het
Crebbp A T 16: 4,085,228 V2049E probably damaging Het
Cryga T C 1: 65,103,223 I4V probably damaging Het
D930020B18Rik A G 10: 121,671,770 T138A probably damaging Het
Dclre1b G T 3: 103,803,148 H482Q probably benign Het
Dpy19l2 A G 9: 24,696,124 S14P probably benign Het
Elavl3 C A 9: 22,036,871 probably benign Het
Ephb6 T C 6: 41,614,569 V220A probably damaging Het
Exoc7 A T 11: 116,297,582 I297N possibly damaging Het
Gdpd4 A T 7: 97,982,875 N332Y probably damaging Het
Ggct C A 6: 54,985,902 E175* probably null Het
Gm5316 T C 6: 122,900,395 noncoding transcript Het
Hoxa7 T C 6: 52,217,383 N8S probably damaging Het
Ifi208 A G 1: 173,683,046 T256A possibly damaging Het
Il12rb2 A G 6: 67,298,919 F630S probably damaging Het
Kit A G 5: 75,622,997 N378S probably benign Het
Lmntd1 T A 6: 145,429,990 Y74F probably benign Het
Lrp1b A T 2: 40,998,038 probably benign Het
Ltbp1 T A 17: 75,364,360 V1194D probably damaging Het
Mc5r T G 18: 68,338,782 S71A probably benign Het
Mcm7 T C 5: 138,164,719 *390W probably null Het
Myo18a T C 11: 77,843,233 probably null Het
Naa25 C A 5: 121,417,976 L276M probably damaging Het
Nlrp1a T G 11: 71,123,381 T348P probably damaging Het
Nlrp1b T G 11: 71,161,929 K888T possibly damaging Het
Olfr1276 A G 2: 111,257,649 Y178C probably benign Het
Pabpc6 A T 17: 9,669,216 N135K probably benign Het
Pdzd2 G A 15: 12,371,605 A2568V possibly damaging Het
Pik3r2 A G 8: 70,770,901 F346S probably damaging Het
Pkd1 T C 17: 24,594,819 W4086R probably damaging Het
Plekhb2 G A 1: 34,866,239 probably benign Het
Plxnb2 A G 15: 89,163,276 probably null Het
Pmfbp1 C T 8: 109,525,407 R395W probably damaging Het
Pnldc1 A G 17: 12,890,119 Y497H probably damaging Het
Ppp1ca T G 19: 4,194,581 V213G possibly damaging Het
Rapgef2 G A 3: 79,087,900 R814C probably damaging Het
Rnasel A T 1: 153,760,775 I634F probably damaging Het
Rnf157 A T 11: 116,349,450 probably benign Het
Ryr3 A G 2: 112,640,666 S4567P probably damaging Het
Stat1 T A 1: 52,140,630 L333Q probably damaging Het
Strc A G 2: 121,368,393 L1391P probably damaging Het
Tek G A 4: 94,837,272 V592M probably damaging Het
Top1 A C 2: 160,702,799 K278N possibly damaging Het
Utrn C T 10: 12,709,956 probably benign Het
Wdr7 T C 18: 63,777,634 I699T probably damaging Het
Zfp30 A G 7: 29,792,435 E119G possibly damaging Het
Other mutations in Smcr8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Smcr8 APN 11 60778632 unclassified probably null
IGL00514:Smcr8 APN 11 60778367 nonsense probably null
IGL01563:Smcr8 APN 11 60783845 missense possibly damaging 0.55
IGL01650:Smcr8 APN 11 60778184 missense probably damaging 1.00
IGL02390:Smcr8 APN 11 60779722 missense probably benign 0.03
IGL02582:Smcr8 APN 11 60778895 missense probably benign 0.00
IGL03008:Smcr8 APN 11 60778461 missense probably damaging 1.00
IGL03286:Smcr8 APN 11 60778027 unclassified probably benign
chauvenist UTSW 11 60778598 missense probably damaging 1.00
patriot UTSW 11 60778032 missense probably damaging 1.00
patriot2 UTSW 11 60778028 start codon destroyed probably null 1.00
patriot3 UTSW 11 60779870 nonsense probably null
R0022:Smcr8 UTSW 11 60780359 missense probably damaging 1.00
R0197:Smcr8 UTSW 11 60778115 missense probably damaging 1.00
R0333:Smcr8 UTSW 11 60780222 missense possibly damaging 0.96
R0346:Smcr8 UTSW 11 60779750 missense probably benign 0.00
R0701:Smcr8 UTSW 11 60778115 missense probably damaging 1.00
R0720:Smcr8 UTSW 11 60778443 missense probably damaging 1.00
R0883:Smcr8 UTSW 11 60778115 missense probably damaging 1.00
R1178:Smcr8 UTSW 11 60779532 missense probably damaging 1.00
R1418:Smcr8 UTSW 11 60778032 missense probably damaging 1.00
R2012:Smcr8 UTSW 11 60778184 missense probably damaging 1.00
R3690:Smcr8 UTSW 11 60778028 start codon destroyed probably null 1.00
R3767:Smcr8 UTSW 11 60779504 missense probably benign 0.30
R4801:Smcr8 UTSW 11 60778610 unclassified probably null
R4802:Smcr8 UTSW 11 60778610 unclassified probably null
R4862:Smcr8 UTSW 11 60778071 missense probably benign 0.01
R5108:Smcr8 UTSW 11 60779870 nonsense probably null
R5361:Smcr8 UTSW 11 60778292 missense probably damaging 1.00
R5745:Smcr8 UTSW 11 60784151 missense probably benign 0.00
R5806:Smcr8 UTSW 11 60780382 critical splice donor site probably null
R6041:Smcr8 UTSW 11 60779568 missense probably damaging 1.00
R6277:Smcr8 UTSW 11 60778809 missense probably benign 0.07
R6289:Smcr8 UTSW 11 60778598 missense probably damaging 1.00
R6445:Smcr8 UTSW 11 60779015 missense possibly damaging 0.95
R6826:Smcr8 UTSW 11 60778862 missense possibly damaging 0.85
R7062:Smcr8 UTSW 11 60780354 missense probably damaging 1.00
R7176:Smcr8 UTSW 11 60778946 missense probably damaging 1.00
R7516:Smcr8 UTSW 11 60779988 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGGAAAACACTGACCCTTCTCCC -3'
(R):5'- TTAGCAACTGTGAATCCCCTGCCC -3'

Sequencing Primer
(F):5'- TGAGCCTGGATAACTACTCGG -3'
(R):5'- CCTGCCCCGTGATAAGAGAAG -3'
Posted On2014-07-08