Incidental Mutation 'R0331:Cmya5'
ID 212535
Institutional Source Beutler Lab
Gene Symbol Cmya5
Ensembl Gene ENSMUSG00000047419
Gene Name cardiomyopathy associated 5
Synonyms Myospryn, 2310076E21Rik, 2310076E16Rik
MMRRC Submission 038540-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock # R0331 (G1)
Quality Score 71
Status Validated
Chromosome 13
Chromosomal Location 93040713-93144724 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 93144403 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Alanine at position 35 (E35A)
Ref Sequence ENSEMBL: ENSMUSP00000050408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048702] [ENSMUST00000062122] [ENSMUST00000225868]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000048702
SMART Domains Protein: ENSMUSP00000048124
Gene: ENSMUSG00000042167

DomainStartEndE-ValueType
low complexity region 134 147 N/A INTRINSIC
Pfam:PAP_assoc 386 440 1.5e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000062122
AA Change: E35A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000050408
Gene: ENSMUSG00000047419
AA Change: E35A

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
internal_repeat_1 448 535 5.09e-18 PROSPERO
internal_repeat_1 543 625 5.09e-18 PROSPERO
low complexity region 626 645 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 734 741 N/A INTRINSIC
low complexity region 1001 1010 N/A INTRINSIC
low complexity region 1166 1183 N/A INTRINSIC
low complexity region 1259 1267 N/A INTRINSIC
low complexity region 1440 1449 N/A INTRINSIC
low complexity region 1876 1889 N/A INTRINSIC
low complexity region 2632 2645 N/A INTRINSIC
low complexity region 3048 3057 N/A INTRINSIC
FN3 3312 3399 7.29e-4 SMART
FN3 3411 3492 1.3e0 SMART
Pfam:SPRY 3551 3668 6.7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223975
Predicted Effect probably benign
Transcript: ENSMUST00000225868
Meta Mutation Damage Score 0.0864 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.8%
  • 20x: 91.7%
Validation Efficiency 100% (81/81)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik T A 8: 79,229,392 T79S probably benign Het
Abtb1 T C 6: 88,840,702 probably benign Het
Acot12 G A 13: 91,760,064 probably null Het
Adamts4 T A 1: 171,250,972 S54T probably benign Het
Adgrl4 T C 3: 151,497,940 S96P probably benign Het
Aip G T 19: 4,118,247 T40K probably damaging Het
Anapc4 A G 5: 52,855,642 probably benign Het
Asz1 A G 6: 18,103,619 probably benign Het
Atf7ip A G 6: 136,561,163 T465A possibly damaging Het
Atp11a C T 8: 12,816,953 Q127* probably null Het
Axin1 A G 17: 26,143,107 R142G probably damaging Het
B230359F08Rik A G 14: 53,795,748 N38S probably benign Het
Bcat1 T A 6: 145,047,314 E86V probably benign Het
Brd4 G A 17: 32,202,515 P749L probably benign Het
C1ra G A 6: 124,519,435 probably null Het
Capza2 A T 6: 17,665,103 N237I probably benign Het
Cd2ap A T 17: 42,805,301 V556E probably benign Het
Cfap65 G A 1: 74,929,301 P124L probably damaging Het
Cfap65 G T 1: 74,929,302 P124T probably damaging Het
Cftr T C 6: 18,235,226 V488A possibly damaging Het
Ckmt1 A T 2: 121,362,856 probably null Het
Col7a1 A G 9: 108,967,502 probably benign Het
Crmp1 C T 5: 37,265,313 L155F possibly damaging Het
Cyp2d10 T A 15: 82,407,026 T33S probably benign Het
Dhdh T C 7: 45,488,120 K48E probably benign Het
Dlst T C 12: 85,118,812 V103A probably damaging Het
Dohh C T 10: 81,387,812 T233I probably benign Het
Dvl2 C A 11: 70,006,217 probably benign Het
Eipr1 C T 12: 28,864,704 Q286* probably null Het
Enpp6 C A 8: 47,082,449 T343K probably damaging Het
Fbxw11 T A 11: 32,711,895 F112I probably damaging Het
Gdpd4 T A 7: 97,973,008 N231K probably benign Het
Gm6370 A T 5: 146,493,766 T254S probably benign Het
Hapln4 G T 8: 70,084,509 Q31H probably damaging Het
Hic1 T A 11: 75,165,490 T858S possibly damaging Het
Isg20l2 T C 3: 87,931,785 L101P probably damaging Het
Itga10 T C 3: 96,652,483 Y485H probably damaging Het
Itgal T A 7: 127,306,681 probably null Het
Itln1 T C 1: 171,531,549 N62S probably damaging Het
Kdm4b T C 17: 56,386,289 probably benign Het
Lct T C 1: 128,298,742 probably benign Het
Lman2 A T 13: 55,353,016 H123Q probably damaging Het
Lztr1 T A 16: 17,524,237 probably benign Het
Myo3b G T 2: 70,095,261 G24V probably damaging Het
Nacad T A 11: 6,599,441 Q1250L possibly damaging Het
Ncor2 A T 5: 125,084,917 M431K unknown Het
Nek9 T A 12: 85,327,375 probably benign Het
Neu1 C A 17: 34,934,170 N255K possibly damaging Het
Nf2 T A 11: 4,794,914 T75S probably benign Het
Nipal4 T A 11: 46,150,213 D385V probably damaging Het
Olah T A 2: 3,342,474 N245I probably damaging Het
Olfr474 G T 7: 107,954,870 L76F probably benign Het
Pag1 T A 3: 9,701,970 T90S probably benign Het
Pald1 A G 10: 61,340,929 probably null Het
Parva A G 7: 112,544,798 M98V probably benign Het
Paxbp1 T A 16: 91,037,367 D177V possibly damaging Het
Paxip1 A G 5: 27,765,232 I587T probably damaging Het
Pclo T C 5: 14,680,376 probably benign Het
Pdgfra T A 5: 75,195,052 D1074E probably damaging Het
Pef1 A T 4: 130,127,448 D265V probably damaging Het
Plekhh2 G A 17: 84,586,366 E870K possibly damaging Het
Plscr4 G A 9: 92,482,642 G40D probably damaging Het
Psg18 A G 7: 18,353,308 Y142H probably benign Het
Ptchd3 A T 11: 121,842,191 M636L probably benign Het
Rab2a A G 4: 8,572,559 D51G probably benign Het
Rnf139 T A 15: 58,899,906 D593E probably benign Het
Sept7 A G 9: 25,306,256 N422S probably benign Het
Shprh T C 10: 11,194,170 probably benign Het
Slc7a6os A G 8: 106,210,567 I87T probably damaging Het
Slc7a7 A G 14: 54,377,924 probably benign Het
Spc24 G T 9: 21,757,313 N129K possibly damaging Het
Strip2 C T 6: 29,926,560 T148I probably benign Het
Tmem150c A C 5: 100,086,273 probably null Het
Ttn G T 2: 76,811,020 Y11801* probably null Het
Usp37 A T 1: 74,454,064 L688* probably null Het
Usp38 T C 8: 80,995,840 I351V probably benign Het
Vav2 T A 2: 27,296,175 M223L probably benign Het
Wdr36 A G 18: 32,852,915 I557M possibly damaging Het
Wwc2 A T 8: 47,880,204 M259K probably benign Het
Znfx1 G A 2: 167,046,978 S770L probably benign Het
Other mutations in Cmya5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Cmya5 APN 13 93093120 missense probably benign 0.13
IGL00516:Cmya5 APN 13 93098167 missense possibly damaging 0.73
IGL00654:Cmya5 APN 13 93094161 missense probably benign 0.00
IGL00948:Cmya5 APN 13 93091036 missense probably benign
IGL00966:Cmya5 APN 13 93097906 missense probably benign 0.33
IGL00988:Cmya5 APN 13 93097933 missense possibly damaging 0.96
IGL01106:Cmya5 APN 13 93084612 missense probably damaging 1.00
IGL01331:Cmya5 APN 13 93096946 missense possibly damaging 0.53
IGL01392:Cmya5 APN 13 93089206 missense probably damaging 0.99
IGL01508:Cmya5 APN 13 93094027 missense probably benign
IGL01679:Cmya5 APN 13 93065320 missense probably damaging 1.00
IGL01749:Cmya5 APN 13 93089299 missense probably benign 0.00
IGL01861:Cmya5 APN 13 93089748 missense probably damaging 1.00
IGL02021:Cmya5 APN 13 93094549 missense probably benign 0.00
IGL02034:Cmya5 APN 13 93084535 splice site probably benign
IGL02103:Cmya5 APN 13 93092127 missense probably benign 0.05
IGL02174:Cmya5 APN 13 93048907 missense possibly damaging 0.76
IGL02176:Cmya5 APN 13 93090150 missense probably damaging 1.00
IGL02210:Cmya5 APN 13 93092734 missense probably benign 0.14
IGL02229:Cmya5 APN 13 93092686 missense possibly damaging 0.54
IGL02306:Cmya5 APN 13 93098019 missense probably damaging 1.00
IGL02311:Cmya5 APN 13 93090655 missense probably benign 0.40
IGL02409:Cmya5 APN 13 93090198 missense probably damaging 0.96
IGL02561:Cmya5 APN 13 93091858 missense probably benign 0.00
IGL02676:Cmya5 APN 13 93092853 missense probably damaging 1.00
IGL02683:Cmya5 APN 13 93090997 nonsense probably null
IGL02685:Cmya5 APN 13 93090997 nonsense probably null
IGL02686:Cmya5 APN 13 93090997 nonsense probably null
IGL02724:Cmya5 APN 13 93096655 missense probably benign
IGL02727:Cmya5 APN 13 93098245 missense possibly damaging 0.73
IGL02965:Cmya5 APN 13 93092557 missense probably benign 0.41
IGL03079:Cmya5 APN 13 93097701 missense possibly damaging 0.85
IGL03144:Cmya5 APN 13 93090868 missense probably damaging 1.00
IGL03253:Cmya5 APN 13 93091270 nonsense probably null
IGL03336:Cmya5 APN 13 93093505 missense possibly damaging 0.84
IGL03138:Cmya5 UTSW 13 93065342 missense probably damaging 1.00
P0023:Cmya5 UTSW 13 93089346 missense probably benign 0.22
P4748:Cmya5 UTSW 13 93074475 splice site probably benign
R0123:Cmya5 UTSW 13 93095904 missense possibly damaging 0.84
R0206:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R0206:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R0242:Cmya5 UTSW 13 93095600 missense probably benign
R0242:Cmya5 UTSW 13 93095600 missense probably benign
R0363:Cmya5 UTSW 13 93094869 missense possibly damaging 0.77
R0382:Cmya5 UTSW 13 93092748 missense probably benign 0.06
R0416:Cmya5 UTSW 13 93089856 missense probably benign 0.05
R0446:Cmya5 UTSW 13 93093656 missense probably benign
R0457:Cmya5 UTSW 13 93095587 missense possibly damaging 0.84
R0673:Cmya5 UTSW 13 93089997 missense probably damaging 1.00
R0674:Cmya5 UTSW 13 93092791 missense probably damaging 1.00
R0692:Cmya5 UTSW 13 93093849 nonsense probably null
R0698:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R1227:Cmya5 UTSW 13 93094446 missense probably damaging 0.99
R1272:Cmya5 UTSW 13 93095112 missense possibly damaging 0.79
R1335:Cmya5 UTSW 13 93041535 missense possibly damaging 0.65
R1353:Cmya5 UTSW 13 93041525 missense probably damaging 1.00
R1354:Cmya5 UTSW 13 93092058 missense possibly damaging 0.46
R1458:Cmya5 UTSW 13 93065327 missense probably benign 0.44
R1572:Cmya5 UTSW 13 93094269 missense possibly damaging 0.61
R1698:Cmya5 UTSW 13 93063519 missense probably benign 0.27
R1735:Cmya5 UTSW 13 93089789 missense probably benign 0.11
R1743:Cmya5 UTSW 13 93097317 missense probably benign 0.33
R1750:Cmya5 UTSW 13 93095663 missense probably benign
R1827:Cmya5 UTSW 13 93074448 missense possibly damaging 0.80
R2068:Cmya5 UTSW 13 93090524 missense possibly damaging 0.93
R2088:Cmya5 UTSW 13 93092812 missense probably damaging 1.00
R2132:Cmya5 UTSW 13 93069383 missense probably damaging 1.00
R2216:Cmya5 UTSW 13 93093495 missense probably damaging 1.00
R2363:Cmya5 UTSW 13 93093702 missense probably benign 0.15
R2497:Cmya5 UTSW 13 93098005 missense possibly damaging 0.53
R2509:Cmya5 UTSW 13 93093558 missense probably benign 0.41
R2917:Cmya5 UTSW 13 93091064 nonsense probably null
R2944:Cmya5 UTSW 13 93092842 nonsense probably null
R3039:Cmya5 UTSW 13 93092250 missense probably benign 0.12
R3078:Cmya5 UTSW 13 93048927 missense probably damaging 0.99
R3708:Cmya5 UTSW 13 93095366 nonsense probably null
R3717:Cmya5 UTSW 13 93092487 missense probably benign 0.12
R3768:Cmya5 UTSW 13 93096693 missense possibly damaging 0.73
R3769:Cmya5 UTSW 13 93096693 missense possibly damaging 0.73
R3840:Cmya5 UTSW 13 93094632 missense probably damaging 0.96
R3841:Cmya5 UTSW 13 93094632 missense probably damaging 0.96
R3882:Cmya5 UTSW 13 93091219 missense probably benign 0.07
R3888:Cmya5 UTSW 13 93093656 missense probably benign
R3897:Cmya5 UTSW 13 93096681 missense possibly damaging 0.72
R3952:Cmya5 UTSW 13 93089199 missense possibly damaging 0.89
R4366:Cmya5 UTSW 13 93091956 missense probably benign 0.36
R4471:Cmya5 UTSW 13 93092325 missense probably benign 0.01
R4493:Cmya5 UTSW 13 93094065 missense probably benign
R4495:Cmya5 UTSW 13 93094065 missense probably benign
R4544:Cmya5 UTSW 13 93091918 nonsense probably null
R4545:Cmya5 UTSW 13 93091918 nonsense probably null
R4624:Cmya5 UTSW 13 93063551 missense probably damaging 1.00
R4648:Cmya5 UTSW 13 93093828 missense possibly damaging 0.84
R4824:Cmya5 UTSW 13 93093574 missense probably benign 0.04
R4965:Cmya5 UTSW 13 93095787 missense possibly damaging 0.84
R4967:Cmya5 UTSW 13 93090585 missense probably damaging 1.00
R5101:Cmya5 UTSW 13 93091603 missense possibly damaging 0.61
R5133:Cmya5 UTSW 13 93093372 missense possibly damaging 0.79
R5139:Cmya5 UTSW 13 93096061 missense probably benign 0.00
R5220:Cmya5 UTSW 13 93092296 missense probably damaging 0.99
R5332:Cmya5 UTSW 13 93096195 missense probably damaging 0.96
R5337:Cmya5 UTSW 13 93083273 missense probably benign 0.28
R5356:Cmya5 UTSW 13 93063485 missense probably damaging 1.00
R5401:Cmya5 UTSW 13 93091968 missense probably damaging 1.00
R5438:Cmya5 UTSW 13 93095199 missense possibly damaging 0.89
R5604:Cmya5 UTSW 13 93092763 missense probably benign 0.15
R5628:Cmya5 UTSW 13 93089710 missense probably damaging 1.00
R5666:Cmya5 UTSW 13 93045949 missense possibly damaging 0.75
R5687:Cmya5 UTSW 13 93098176 missense possibly damaging 0.53
R5695:Cmya5 UTSW 13 93045866 critical splice donor site probably null
R5806:Cmya5 UTSW 13 93093937 missense possibly damaging 0.84
R5820:Cmya5 UTSW 13 93092780 missense probably benign 0.04
R5872:Cmya5 UTSW 13 93097435 missense probably benign 0.01
R5875:Cmya5 UTSW 13 93095184 missense probably benign 0.13
R5896:Cmya5 UTSW 13 93045865 critical splice donor site probably null
R5910:Cmya5 UTSW 13 93092643 missense probably damaging 0.98
R5969:Cmya5 UTSW 13 93089544 missense possibly damaging 0.78
R6064:Cmya5 UTSW 13 93089649 missense probably damaging 1.00
R6081:Cmya5 UTSW 13 93144513 unclassified probably benign
R6102:Cmya5 UTSW 13 93094231 missense probably benign
R6117:Cmya5 UTSW 13 93095166 missense probably damaging 0.98
R6188:Cmya5 UTSW 13 93093444 missense possibly damaging 0.61
R6188:Cmya5 UTSW 13 93097276 missense possibly damaging 0.73
R6219:Cmya5 UTSW 13 93094443 missense probably damaging 1.00
R6229:Cmya5 UTSW 13 93093306 missense probably benign 0.41
R6346:Cmya5 UTSW 13 93092190 missense probably damaging 1.00
R6431:Cmya5 UTSW 13 93074464 missense possibly damaging 0.60
R6436:Cmya5 UTSW 13 93089215 missense probably damaging 0.98
R6598:Cmya5 UTSW 13 93089808 missense probably benign 0.05
R6649:Cmya5 UTSW 13 93098025 missense possibly damaging 0.91
R6652:Cmya5 UTSW 13 93092895 missense probably benign 0.04
R6652:Cmya5 UTSW 13 93093039 missense probably damaging 0.99
R6669:Cmya5 UTSW 13 93093259 missense probably benign 0.03
R6881:Cmya5 UTSW 13 93090292 missense probably damaging 1.00
R6909:Cmya5 UTSW 13 93091252 missense probably benign 0.04
R6933:Cmya5 UTSW 13 93095136 missense probably benign 0.03
R7021:Cmya5 UTSW 13 93093555 missense possibly damaging 0.62
R7022:Cmya5 UTSW 13 93069278 critical splice donor site probably null
R7068:Cmya5 UTSW 13 93092697 missense possibly damaging 0.59
R7087:Cmya5 UTSW 13 93090975 missense probably benign 0.00
R7088:Cmya5 UTSW 13 93091864 missense possibly damaging 0.95
R7126:Cmya5 UTSW 13 93089940 missense probably benign 0.41
R7177:Cmya5 UTSW 13 93095328 missense probably benign 0.00
R7188:Cmya5 UTSW 13 93046038 missense probably damaging 1.00
R7217:Cmya5 UTSW 13 93090430 missense probably damaging 1.00
R7278:Cmya5 UTSW 13 93095700 missense probably damaging 0.96
R7293:Cmya5 UTSW 13 93092797 missense possibly damaging 0.90
R7332:Cmya5 UTSW 13 93092553 missense possibly damaging 0.60
R7375:Cmya5 UTSW 13 93091661 missense probably damaging 0.97
R7386:Cmya5 UTSW 13 93069323 missense probably damaging 1.00
R7489:Cmya5 UTSW 13 93091838 missense possibly damaging 0.87
R7529:Cmya5 UTSW 13 93097434 missense probably benign 0.02
R7552:Cmya5 UTSW 13 93069312 missense probably benign 0.41
R7624:Cmya5 UTSW 13 93090357 missense possibly damaging 0.79
R7637:Cmya5 UTSW 13 93083212 missense possibly damaging 0.87
R7673:Cmya5 UTSW 13 93094121 missense probably benign 0.13
R7753:Cmya5 UTSW 13 93098172 missense probably benign 0.18
R7757:Cmya5 UTSW 13 93098272 missense possibly damaging 0.53
R7806:Cmya5 UTSW 13 93094262 missense probably benign 0.00
R7825:Cmya5 UTSW 13 93097628 missense possibly damaging 0.53
R7878:Cmya5 UTSW 13 93089757 missense probably damaging 0.98
R7892:Cmya5 UTSW 13 93096357 missense probably damaging 0.96
R7952:Cmya5 UTSW 13 93097004 small deletion probably benign
R8127:Cmya5 UTSW 13 93094614 missense probably damaging 0.99
R8256:Cmya5 UTSW 13 93093478 missense possibly damaging 0.62
R8339:Cmya5 UTSW 13 93091634 nonsense probably null
R8446:Cmya5 UTSW 13 93093828 missense possibly damaging 0.84
R8553:Cmya5 UTSW 13 93093796 missense probably benign 0.00
R8686:Cmya5 UTSW 13 93095380 missense possibly damaging 0.91
R8748:Cmya5 UTSW 13 93089721 missense probably damaging 1.00
R8783:Cmya5 UTSW 13 93089380 missense possibly damaging 0.58
R8803:Cmya5 UTSW 13 93041483 missense probably damaging 1.00
R8810:Cmya5 UTSW 13 93063540 missense possibly damaging 0.47
R8937:Cmya5 UTSW 13 93096332 missense probably benign 0.01
R8985:Cmya5 UTSW 13 93097156 missense possibly damaging 0.73
R9017:Cmya5 UTSW 13 93092064 missense probably benign 0.03
R9087:Cmya5 UTSW 13 93097203 missense possibly damaging 0.72
R9133:Cmya5 UTSW 13 93097600 missense possibly damaging 0.73
R9156:Cmya5 UTSW 13 93097370 missense unknown
R9209:Cmya5 UTSW 13 93090358 missense probably benign 0.45
R9222:Cmya5 UTSW 13 93094071 missense probably benign 0.00
R9229:Cmya5 UTSW 13 93095668 missense possibly damaging 0.92
R9382:Cmya5 UTSW 13 93093376 missense probably benign
R9385:Cmya5 UTSW 13 93094372 missense probably damaging 0.99
R9418:Cmya5 UTSW 13 93089701 missense probably benign 0.22
R9452:Cmya5 UTSW 13 93095886 missense probably benign
RF020:Cmya5 UTSW 13 93069291 missense possibly damaging 0.56
X0028:Cmya5 UTSW 13 93096687 missense possibly damaging 0.53
Z1088:Cmya5 UTSW 13 93063579 missense probably benign
Z1176:Cmya5 UTSW 13 93063579 missense probably benign
Z1176:Cmya5 UTSW 13 93096790 missense unknown
Z1177:Cmya5 UTSW 13 93063579 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCGGGGAAATGAACTTCTGAGGTTG -3'
(R):5'- GCCGCTGAAGATCTGCCAAAAC -3'

Sequencing Primer
(F):5'- TGAACTTCTGAGGTTGGAAAGG -3'
(R):5'- CGTGGCGAAACTTTCTTGAC -3'
Posted On 2014-07-08