Incidental Mutation 'R0403:Nrp1'
ID212538
Institutional Source Beutler Lab
Gene Symbol Nrp1
Ensembl Gene ENSMUSG00000025810
Gene Nameneuropilin 1
SynonymsNeuropilin-1, NP-1, NPN-1, Npn1
MMRRC Submission 038608-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0403 (G1)
Quality Score60
Status Validated
Chromosome8
Chromosomal Location128358604-128503363 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128457969 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 365 (N365S)
Ref Sequence ENSEMBL: ENSMUSP00000026917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026917]
PDB Structure Mouse Neuropilin-1, extracellular domains 1-4 (a1a2b1b2) [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000026917
AA Change: N365S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026917
Gene: ENSMUSG00000025810
AA Change: N365S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CUB 27 141 1.44e-43 SMART
CUB 147 265 9.19e-42 SMART
FA58C 274 424 5.21e-44 SMART
FA58C 430 583 4.15e-20 SMART
low complexity region 587 599 N/A INTRINSIC
MAM 645 811 4.94e-69 SMART
Pfam:DUF3481 837 920 3.5e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212933
Meta Mutation Damage Score 0.1612 question?
Coding Region Coverage
  • 1x: 98.0%
  • 3x: 96.8%
  • 10x: 93.2%
  • 20x: 83.7%
Validation Efficiency 97% (110/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two neuropilins, which contain specific protein domains which allow them to participate in several different types of signaling pathways that control cell migration. Neuropilins contain a large N-terminal extracellular domain, made up of complement-binding, coagulation factor V/VIII, and meprin domains. These proteins also contains a short membrane-spanning domain and a small cytoplasmic domain. Neuropilins bind many ligands and various types of co-receptors; they affect cell survival, migration, and attraction. Some of the ligands and co-receptors bound by neuropilins are vascular endothelial growth factor (VEGF) and semaphorin family members. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice show embryonic death, impaired neuronal migration and axon guidance, and vascular defects including a disorganized yolk sac vascular plexus, and malformed brachial arch arteries and great vessels. Mice lacking the cytoplasmic domain show altered retinal arteriovenous patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace A G 11: 105,973,880 probably null Het
Adgrg3 C T 8: 95,036,922 L284F probably benign Het
Alkbh8 T A 9: 3,385,469 V587E probably damaging Het
Ap4b1 T A 3: 103,818,839 C244S probably damaging Het
Ap4b1 T A 3: 103,821,396 M590K probably benign Het
Arhgap15 C T 2: 44,063,766 T168I probably damaging Het
Arntl2 T A 6: 146,822,655 H348Q probably damaging Het
Atp8b1 A G 18: 64,540,310 V997A probably damaging Het
Atrn G A 2: 130,906,859 C100Y probably damaging Het
Baiap2l2 C A 15: 79,271,216 A151S probably benign Het
Baz2b A T 2: 59,969,377 D199E possibly damaging Het
Cblb A G 16: 52,152,626 D440G probably benign Het
Cdon T C 9: 35,473,500 V694A probably benign Het
Cep250 A T 2: 155,992,349 R2065W probably damaging Het
Ces2b G T 8: 104,833,945 A131S probably damaging Het
Chrna9 A T 5: 65,967,892 T59S possibly damaging Het
Cog3 T A 14: 75,742,327 probably benign Het
Cpa1 G A 6: 30,641,857 V227I probably benign Het
Cyp3a25 A T 5: 145,998,513 C98S probably damaging Het
D8Ertd738e C T 8: 84,249,601 probably null Het
Ddx60 A G 8: 61,994,541 probably benign Het
Dhx16 T C 17: 35,883,050 probably null Het
Dnah9 T A 11: 66,084,789 Q1478L possibly damaging Het
Dock10 T C 1: 80,524,070 Y1434C possibly damaging Het
Enpp3 T A 10: 24,804,436 D325V probably damaging Het
Entpd6 C A 2: 150,760,170 T194K possibly damaging Het
Fam208b A T 13: 3,582,052 Y816* probably null Het
Fat2 A T 11: 55,270,349 V3185E probably benign Het
Flrt1 A G 19: 7,095,919 L421P probably benign Het
Fmn2 A T 1: 174,694,278 Q1292L probably damaging Het
Fndc1 T C 17: 7,775,588 probably null Het
Fndc1 T C 17: 7,753,723 D1459G probably damaging Het
Fzr1 A G 10: 81,369,368 S265P possibly damaging Het
Gm13119 A G 4: 144,362,646 N178S probably benign Het
Gm14085 T C 2: 122,521,854 L364S probably damaging Het
Gpr142 G A 11: 114,806,029 V134M probably damaging Het
Grid2ip G T 5: 143,357,620 V24L possibly damaging Het
Herc2 G A 7: 56,159,417 R2555H probably damaging Het
Hpdl A T 4: 116,820,479 Y262N possibly damaging Het
Htr3a A G 9: 48,908,659 V57A probably damaging Het
Igfbp7 T C 5: 77,355,591 I186V probably benign Het
Itga2b C T 11: 102,467,326 probably null Het
Itgae A C 11: 73,123,183 D736A possibly damaging Het
Itpkc T A 7: 27,208,345 M645L probably benign Het
Jchain T C 5: 88,521,378 R139G probably benign Het
Kif13a A G 13: 46,791,401 V908A probably damaging Het
Kif1b T A 4: 149,181,967 K389* probably null Het
Klhl12 T C 1: 134,485,856 Y360H possibly damaging Het
Knop1 G A 7: 118,853,053 R148W probably damaging Het
Lpar1 T A 4: 58,487,191 N27Y probably damaging Het
Lpar2 T A 8: 69,824,152 V197D probably damaging Het
Lrrc74a A G 12: 86,740,979 N128S probably damaging Het
Lum G T 10: 97,572,043 V337F probably benign Het
Mag T C 7: 30,906,980 D344G probably damaging Het
Maip1 G A 1: 57,407,196 A142T probably benign Het
Mlh3 A G 12: 85,268,968 V148A possibly damaging Het
Nav3 A G 10: 109,767,103 V1195A probably damaging Het
Ncor2 A G 5: 125,033,337 S868P possibly damaging Het
Nek1 A G 8: 61,106,855 E907G probably damaging Het
Nfam1 G A 15: 83,016,379 T134I probably benign Het
Nr0b2 T C 4: 133,553,759 V112A probably damaging Het
Nrsn2 T C 2: 152,369,790 Y107C probably damaging Het
Ntng1 G A 3: 109,934,611 A282V probably damaging Het
Nxf1 T C 19: 8,765,028 I337T probably damaging Het
Obscn C T 11: 59,076,540 G479D probably damaging Het
Olfr45 T C 7: 140,691,309 S135P possibly damaging Het
Oprd1 T A 4: 132,113,768 D293V probably benign Het
P3h2 T G 16: 25,969,950 N586H possibly damaging Het
Pcid2 T C 8: 13,085,367 Y214C probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Ppic C A 18: 53,411,071 G81W probably damaging Het
Ppp2r1a C A 17: 20,957,041 P246T probably damaging Het
Ppp4r4 T G 12: 103,584,102 S46A probably benign Het
Prkce A G 17: 86,168,653 T21A probably damaging Het
Prkg2 T C 5: 98,994,645 E210G possibly damaging Het
Prss35 A G 9: 86,756,037 M287V probably damaging Het
Psd G A 19: 46,320,972 probably benign Het
Ptch2 A T 4: 117,110,839 K843* probably null Het
Rab44 C A 17: 29,145,261 T603K probably damaging Het
Rasal3 T A 17: 32,392,790 probably null Het
Rbbp6 A G 7: 122,992,296 T526A probably damaging Het
Ros1 A T 10: 52,143,438 probably benign Het
Sec24b T A 3: 129,989,676 L1104F possibly damaging Het
Sec24b A G 3: 129,999,534 S685P probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Setmar A T 6: 108,075,962 H139L probably benign Het
Slc4a7 T C 14: 14,766,808 V710A probably benign Het
Smarcc1 T A 9: 110,237,808 probably null Het
Smchd1 G A 17: 71,394,902 L1032F probably damaging Het
Speg T C 1: 75,430,784 probably benign Het
Tcea1 C G 1: 4,889,503 R134G probably benign Het
Tchhl1 C T 3: 93,471,029 Q347* probably null Het
Tecrl A T 5: 83,354,758 probably benign Het
Tepsin T C 11: 120,093,682 probably benign Het
Tmem40 G A 6: 115,733,985 probably benign Het
Tpr G A 1: 150,407,414 probably benign Het
Ttll12 A T 15: 83,580,658 probably benign Het
Ttn T A 2: 76,909,608 D3529V probably benign Het
Usp34 T A 11: 23,333,838 H177Q possibly damaging Het
Vsig10 T A 5: 117,338,461 S327T probably benign Het
Zbtb4 T A 11: 69,777,639 M396K probably damaging Het
Zfp352 C T 4: 90,225,009 T462I possibly damaging Het
Zfp385b T C 2: 77,476,845 M145V probably damaging Het
Zfp780b C A 7: 27,971,689 V65F possibly damaging Het
Other mutations in Nrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Nrp1 APN 8 128476207 missense probably benign
IGL01412:Nrp1 APN 8 128418707 splice site probably benign
IGL01586:Nrp1 APN 8 128432032 missense possibly damaging 0.86
IGL02307:Nrp1 APN 8 128502720 missense probably damaging 1.00
IGL02500:Nrp1 APN 8 128425799 missense possibly damaging 0.94
IGL02547:Nrp1 APN 8 128493031 missense probably benign
R0046:Nrp1 UTSW 8 128500608 splice site probably benign
R0281:Nrp1 UTSW 8 128460683 missense probably damaging 0.96
R0610:Nrp1 UTSW 8 128502618 missense probably damaging 1.00
R1055:Nrp1 UTSW 8 128468598 missense possibly damaging 0.68
R1229:Nrp1 UTSW 8 128418716 nonsense probably null
R1263:Nrp1 UTSW 8 128468389 missense probably damaging 1.00
R1340:Nrp1 UTSW 8 128434355 missense probably damaging 1.00
R1397:Nrp1 UTSW 8 128418716 nonsense probably null
R1462:Nrp1 UTSW 8 128502798 missense probably benign
R1462:Nrp1 UTSW 8 128502798 missense probably benign
R1531:Nrp1 UTSW 8 128425969 missense probably null 0.19
R1587:Nrp1 UTSW 8 128476282 missense probably damaging 1.00
R1719:Nrp1 UTSW 8 128425885 missense probably damaging 1.00
R1733:Nrp1 UTSW 8 128468493 missense probably benign 0.02
R1785:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R1786:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R2047:Nrp1 UTSW 8 128498096 splice site probably benign
R2130:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R2132:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R2133:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R2163:Nrp1 UTSW 8 128497871 missense probably damaging 1.00
R2338:Nrp1 UTSW 8 128497904 missense probably benign 0.01
R2407:Nrp1 UTSW 8 128431945 missense probably damaging 0.99
R3405:Nrp1 UTSW 8 128498088 nonsense probably null
R3748:Nrp1 UTSW 8 128457980 missense probably damaging 1.00
R4347:Nrp1 UTSW 8 128480991 critical splice donor site probably null
R4379:Nrp1 UTSW 8 128468467 missense probably damaging 1.00
R4646:Nrp1 UTSW 8 128457944 missense probably benign 0.00
R4688:Nrp1 UTSW 8 128502566 missense probably benign 0.01
R4916:Nrp1 UTSW 8 128502804 nonsense probably null
R5077:Nrp1 UTSW 8 128500673 critical splice donor site probably null
R5301:Nrp1 UTSW 8 128434197 splice site probably null
R5509:Nrp1 UTSW 8 128425915 missense possibly damaging 0.73
R5745:Nrp1 UTSW 8 128468448 missense probably benign 0.22
R5873:Nrp1 UTSW 8 128468377 missense probably damaging 1.00
R5987:Nrp1 UTSW 8 128476169 missense probably damaging 1.00
R6060:Nrp1 UTSW 8 128497938 missense probably damaging 1.00
R6757:Nrp1 UTSW 8 128425868 missense probably damaging 1.00
R6889:Nrp1 UTSW 8 128493057 missense probably damaging 1.00
R7025:Nrp1 UTSW 8 128480954 missense probably damaging 1.00
R7065:Nrp1 UTSW 8 128460712 missense probably benign
R7290:Nrp1 UTSW 8 128476296 critical splice donor site probably null
R7369:Nrp1 UTSW 8 128431915 missense probably damaging 1.00
R7553:Nrp1 UTSW 8 128431987 missense probably damaging 1.00
R7650:Nrp1 UTSW 8 128498014 missense possibly damaging 0.87
R8043:Nrp1 UTSW 8 128432023 missense probably benign 0.00
R8088:Nrp1 UTSW 8 128468516 nonsense probably null
R8193:Nrp1 UTSW 8 128460706 missense probably damaging 1.00
R8206:Nrp1 UTSW 8 128457957 missense probably damaging 0.99
R8245:Nrp1 UTSW 8 128487953 missense probably benign
R8684:Nrp1 UTSW 8 128359404 start gained probably benign
R8734:Nrp1 UTSW 8 128480939 missense probably benign 0.23
R8875:Nrp1 UTSW 8 128480991 critical splice donor site probably null
X0066:Nrp1 UTSW 8 128460645 missense possibly damaging 0.95
Z1186:Nrp1 UTSW 8 128497938 missense probably damaging 1.00
Z1189:Nrp1 UTSW 8 128497938 missense probably damaging 1.00
Z1192:Nrp1 UTSW 8 128497938 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGATAGGGGCCATTGACATCAC -3'
(R):5'- TGAAGCCAAATGACTGTCAGGAACC -3'

Sequencing Primer
(F):5'- GCCATTGACATCACATTGGG -3'
(R):5'- CTGGGAACATGAGACTCTTTAAACC -3'
Posted On2014-07-08