Incidental Mutation 'R0485:Bicc1'
ID212545
Institutional Source Beutler Lab
Gene Symbol Bicc1
Ensembl Gene ENSMUSG00000014329
Gene NameBicC family RNA binding protein 1
SynonymsBic-C, jcpk
MMRRC Submission 038684-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0485 (G1)
Quality Score77
Status Validated
Chromosome10
Chromosomal Location70922832-71159700 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 70925315 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 955 (E955A)
Ref Sequence ENSEMBL: ENSMUSP00000123201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014473] [ENSMUST00000131445] [ENSMUST00000143791]
Predicted Effect probably benign
Transcript: ENSMUST00000014473
SMART Domains Protein: ENSMUSP00000014473
Gene: ENSMUSG00000014329

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 2.04e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000058942
Predicted Effect probably benign
Transcript: ENSMUST00000131445
SMART Domains Protein: ENSMUSP00000119137
Gene: ENSMUSG00000014329

DomainStartEndE-ValueType
SCOP:d1dtja_ 1 46 1e-2 SMART
Blast:KH 1 47 1e-22 BLAST
KH 51 124 6.24e-18 SMART
KH 203 273 1.25e-8 SMART
low complexity region 302 320 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
low complexity region 398 417 N/A INTRINSIC
low complexity region 618 636 N/A INTRINSIC
low complexity region 654 665 N/A INTRINSIC
low complexity region 712 733 N/A INTRINSIC
SAM 790 856 2.04e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143791
AA Change: E955A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123201
Gene: ENSMUSG00000014329
AA Change: E955A

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 4.26e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218757
Meta Mutation Damage Score 0.1134 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency 100% (95/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is active in regulating gene expression by modulating protein translation during embryonic development. Mouse studies identified the corresponding protein to be under strict control during cell differentiation and to be a maternally provided gene product. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene causes heteroxia, impaired nodal flow, ventricular septal defects, partial prenatal lethality and postnatal death due to renal failure. Chemically induced mutants develop kidney cysts and may show bulging abdomens, bile duct anomalies and cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik A G 16: 3,907,647 V5A probably damaging Het
Abi3bp A G 16: 56,604,012 probably null Het
Acot11 G A 4: 106,762,027 R184C probably damaging Het
Adgre5 A T 8: 83,731,998 I133N probably damaging Het
Afap1 A T 5: 35,951,003 Q231L probably damaging Het
Alg12 T C 15: 88,811,427 T289A probably benign Het
Ank3 T A 10: 69,882,544 S542T possibly damaging Het
Ankmy2 G A 12: 36,182,390 R138Q possibly damaging Het
Ascc2 C T 11: 4,672,302 A456V probably benign Het
Atg4c G A 4: 99,224,482 V289I probably benign Het
Bbs7 A T 3: 36,602,873 Y269N probably damaging Het
Bcas3 T A 11: 85,495,850 D370E probably damaging Het
Bok T C 1: 93,689,277 F115S probably damaging Het
Caap1 A T 4: 94,550,521 probably null Het
Cacna2d3 T A 14: 29,534,519 M95L possibly damaging Het
Calcrl T A 2: 84,370,091 D115V probably benign Het
Car7 A T 8: 104,543,538 M57L probably benign Het
Casq1 G T 1: 172,210,390 probably benign Het
Cep290 A T 10: 100,549,344 D1894V possibly damaging Het
Clec4a2 T A 6: 123,123,629 N14K probably damaging Het
Col16a1 G T 4: 130,090,497 probably benign Het
Col5a1 T C 2: 27,990,097 probably benign Het
Col5a2 A T 1: 45,378,482 I1311N probably damaging Het
Col5a3 T C 9: 20,782,708 T1050A probably damaging Het
Colgalt2 A T 1: 152,484,871 I220F probably damaging Het
Cpb1 A T 3: 20,275,628 V8E unknown Het
Dchs1 C T 7: 105,772,727 R162H probably benign Het
Dhx37 A G 5: 125,422,231 Y638H probably benign Het
Dhx40 T G 11: 86,771,262 probably benign Het
Ehd2 T A 7: 15,952,076 Q357L probably benign Het
Ewsr1 T C 11: 5,070,737 probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Gid8 T A 2: 180,713,211 Y3* probably null Het
Gm10212 A C 19: 11,570,810 noncoding transcript Het
Gm4763 C A 7: 24,722,745 C193F possibly damaging Het
Gm597 G T 1: 28,778,142 Q270K probably damaging Het
Gm960 A T 19: 4,658,414 I350N probably damaging Het
Grin3b T A 10: 79,974,056 N465K possibly damaging Het
Hist1h1d A T 13: 23,555,750 K221* probably null Het
Htr4 A T 18: 62,428,154 N162I probably damaging Het
Itga3 T C 11: 95,061,970 D325G probably benign Het
Itpr3 T G 17: 27,111,929 V1737G probably damaging Het
Kcnab2 C T 4: 152,394,982 V251I probably benign Het
Kcnn2 A T 18: 45,560,148 I264L probably benign Het
Klhl41 T C 2: 69,671,256 Y354H probably damaging Het
Klra6 T C 6: 130,023,638 I68V probably benign Het
Letm2 G T 8: 25,592,558 P178Q probably damaging Het
Lrmp T C 6: 145,165,212 C248R probably damaging Het
Mbtps1 A T 8: 119,522,601 probably benign Het
Mecom C T 3: 29,980,972 probably benign Het
Mrps5 T A 2: 127,591,825 S45T possibly damaging Het
Msra T A 14: 64,440,761 I29F possibly damaging Het
Mup5 T C 4: 61,832,992 probably null Het
Myo1a T C 10: 127,719,242 probably benign Het
Myrip C A 9: 120,441,377 N564K probably benign Het
Naa20 T A 2: 145,915,672 D148E probably damaging Het
Naga T G 15: 82,336,755 probably benign Het
Npc1 A G 18: 12,213,446 V231A probably benign Het
Nphs1 T C 7: 30,467,515 F716L probably benign Het
Olfr284 T C 15: 98,340,929 H20R probably benign Het
Parn G C 16: 13,654,435 probably benign Het
Polk A T 13: 96,483,764 C664S probably benign Het
Prkar2b A G 12: 31,976,035 probably benign Het
Prkdc A G 16: 15,833,740 E3747G probably damaging Het
Prmt5 A T 14: 54,511,255 M362K probably damaging Het
Prob1 T C 18: 35,653,825 T459A possibly damaging Het
Rttn C T 18: 89,090,419 probably benign Het
Scn1a T C 2: 66,273,925 M1664V probably damaging Het
Sez6 T A 11: 77,953,813 L154H probably damaging Het
Sh3tc1 A G 5: 35,702,012 probably benign Het
Shkbp1 C T 7: 27,348,581 G334D probably damaging Het
Slc8a1 A T 17: 81,647,993 F539I probably damaging Het
Sptan1 T C 2: 30,013,848 probably benign Het
Ssc5d C T 7: 4,937,471 T861M probably damaging Het
Tbx5 A T 5: 119,883,458 M510L probably benign Het
Tdp1 A G 12: 99,909,842 T351A probably benign Het
Tmc8 T A 11: 117,792,078 probably benign Het
Tmco5 T A 2: 116,890,107 D205E probably benign Het
Tmprss2 T C 16: 97,571,994 probably benign Het
Tph1 T A 7: 46,650,024 K364N probably benign Het
Trim24 T C 6: 37,957,066 L648P probably damaging Het
Trmt6 C A 2: 132,809,030 probably benign Het
Ube2i A T 17: 25,269,285 probably benign Het
Vcan A C 13: 89,704,660 L727R possibly damaging Het
Vmn2r28 T C 7: 5,488,690 Y186C probably damaging Het
Wars C A 12: 108,875,157 D232Y probably damaging Het
Xrcc5 T C 1: 72,338,945 probably benign Het
Zbtb24 T A 10: 41,464,536 S543T probably damaging Het
Zfp91 A G 19: 12,775,989 probably benign Het
Other mutations in Bicc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Bicc1 APN 10 70961157 missense probably damaging 1.00
IGL01988:Bicc1 APN 10 70956176 missense probably damaging 1.00
IGL02686:Bicc1 APN 10 70943360 splice site probably benign
IGL02829:Bicc1 APN 10 70958880 missense probably damaging 1.00
IGL03276:Bicc1 APN 10 70953438 missense possibly damaging 0.76
IGL03354:Bicc1 APN 10 70946602 missense probably benign 0.00
artemis UTSW 10 71027954 missense probably damaging 0.99
Pebbles UTSW 10 70947900 missense possibly damaging 0.95
PIT1430001:Bicc1 UTSW 10 70957681 missense possibly damaging 0.94
R0095:Bicc1 UTSW 10 70961158 missense probably damaging 1.00
R0142:Bicc1 UTSW 10 70925370 missense probably damaging 1.00
R0184:Bicc1 UTSW 10 71079215 missense probably benign
R0469:Bicc1 UTSW 10 71079215 missense probably benign
R0520:Bicc1 UTSW 10 70957190 missense probably damaging 0.96
R0884:Bicc1 UTSW 10 70958847 missense probably damaging 1.00
R1678:Bicc1 UTSW 10 70943518 missense probably damaging 1.00
R1892:Bicc1 UTSW 10 70958784 missense probably damaging 1.00
R1943:Bicc1 UTSW 10 71159523 missense probably damaging 1.00
R2220:Bicc1 UTSW 10 70950125 missense probably damaging 1.00
R2240:Bicc1 UTSW 10 70946803 critical splice donor site probably null
R2519:Bicc1 UTSW 10 70930644 missense probably damaging 1.00
R4362:Bicc1 UTSW 10 70943374 frame shift probably null
R4363:Bicc1 UTSW 10 70943374 frame shift probably null
R4419:Bicc1 UTSW 10 70946974 missense possibly damaging 0.73
R4697:Bicc1 UTSW 10 70953484 missense possibly damaging 0.87
R4728:Bicc1 UTSW 10 70935831 critical splice donor site probably null
R4765:Bicc1 UTSW 10 70940593 missense probably damaging 1.00
R4838:Bicc1 UTSW 10 70945316 missense possibly damaging 0.50
R5022:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5023:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5057:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5082:Bicc1 UTSW 10 70940522 missense probably benign 0.05
R5160:Bicc1 UTSW 10 70932236 missense probably damaging 1.00
R5294:Bicc1 UTSW 10 70947900 missense possibly damaging 0.95
R5639:Bicc1 UTSW 10 70940520 missense probably damaging 1.00
R5749:Bicc1 UTSW 10 70946969 missense probably benign 0.00
R6045:Bicc1 UTSW 10 70957081 nonsense probably null
R6128:Bicc1 UTSW 10 70940483 splice site probably null
R6277:Bicc1 UTSW 10 71027901 missense possibly damaging 0.74
R6389:Bicc1 UTSW 10 70958922 missense probably damaging 1.00
R7021:Bicc1 UTSW 10 70961148 missense probably damaging 0.99
R7101:Bicc1 UTSW 10 70930653 missense probably damaging 1.00
R7351:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7352:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7353:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7366:Bicc1 UTSW 10 70943386 missense probably benign 0.01
R7480:Bicc1 UTSW 10 70943476 missense probably damaging 1.00
R7541:Bicc1 UTSW 10 70946604 missense possibly damaging 0.82
R7544:Bicc1 UTSW 10 70956374 missense possibly damaging 0.89
R7555:Bicc1 UTSW 10 70956291 missense possibly damaging 0.75
R7663:Bicc1 UTSW 10 70946590 missense probably benign
R7671:Bicc1 UTSW 10 70957167 missense probably benign 0.01
R7747:Bicc1 UTSW 10 70946993 missense probably benign
RF013:Bicc1 UTSW 10 70935830 critical splice donor site probably null
X0028:Bicc1 UTSW 10 70945336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGTCCTGATACCAGACACTCCG -3'
(R):5'- AACAAACACCATTTGCCCTGGTTTC -3'

Sequencing Primer
(F):5'- GACACTCCGAGTGCCAAG -3'
(R):5'- AGTAACTAGAATGTCTACCTTCTGCC -3'
Posted On2014-07-09