Incidental Mutation 'R0076:Col9a1'
ID212547
Institutional Source Beutler Lab
Gene Symbol Col9a1
Ensembl Gene ENSMUSG00000026147
Gene Namecollagen, type IX, alpha 1
SynonymsCol9a-1
MMRRC Submission 038363-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R0076 (G1)
Quality Score43
Status Validated
Chromosome1
Chromosomal Location24177610-24252684 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 24237497 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000085687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054588] [ENSMUST00000054588] [ENSMUST00000054588] [ENSMUST00000054588] [ENSMUST00000088349] [ENSMUST00000088349] [ENSMUST00000088349] [ENSMUST00000088349] [ENSMUST00000088349]
Predicted Effect probably null
Transcript: ENSMUST00000054588
SMART Domains Protein: ENSMUSP00000051579
Gene: ENSMUSG00000026147

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 50 244 5.73e-78 SMART
Pfam:Collagen 266 326 2e-11 PFAM
Pfam:Collagen 308 358 3.5e-9 PFAM
Pfam:Collagen 357 409 1.2e-8 PFAM
Pfam:Collagen 415 472 7.8e-11 PFAM
Pfam:Collagen 454 515 2.9e-11 PFAM
Pfam:Collagen 592 667 3.9e-8 PFAM
Pfam:Collagen 646 716 1.7e-9 PFAM
Pfam:Collagen 697 760 1.6e-10 PFAM
Pfam:Collagen 785 848 3.1e-11 PFAM
low complexity region 878 899 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000054588
SMART Domains Protein: ENSMUSP00000051579
Gene: ENSMUSG00000026147

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 50 244 5.73e-78 SMART
Pfam:Collagen 266 326 2e-11 PFAM
Pfam:Collagen 308 358 3.5e-9 PFAM
Pfam:Collagen 357 409 1.2e-8 PFAM
Pfam:Collagen 415 472 7.8e-11 PFAM
Pfam:Collagen 454 515 2.9e-11 PFAM
Pfam:Collagen 592 667 3.9e-8 PFAM
Pfam:Collagen 646 716 1.7e-9 PFAM
Pfam:Collagen 697 760 1.6e-10 PFAM
Pfam:Collagen 785 848 3.1e-11 PFAM
low complexity region 878 899 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000054588
SMART Domains Protein: ENSMUSP00000051579
Gene: ENSMUSG00000026147

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 50 244 5.73e-78 SMART
Pfam:Collagen 266 326 2e-11 PFAM
Pfam:Collagen 308 358 3.5e-9 PFAM
Pfam:Collagen 357 409 1.2e-8 PFAM
Pfam:Collagen 415 472 7.8e-11 PFAM
Pfam:Collagen 454 515 2.9e-11 PFAM
Pfam:Collagen 592 667 3.9e-8 PFAM
Pfam:Collagen 646 716 1.7e-9 PFAM
Pfam:Collagen 697 760 1.6e-10 PFAM
Pfam:Collagen 785 848 3.1e-11 PFAM
low complexity region 878 899 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000054588
SMART Domains Protein: ENSMUSP00000051579
Gene: ENSMUSG00000026147

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 50 244 5.73e-78 SMART
Pfam:Collagen 266 326 2e-11 PFAM
Pfam:Collagen 308 358 3.5e-9 PFAM
Pfam:Collagen 357 409 1.2e-8 PFAM
Pfam:Collagen 415 472 7.8e-11 PFAM
Pfam:Collagen 454 515 2.9e-11 PFAM
Pfam:Collagen 592 667 3.9e-8 PFAM
Pfam:Collagen 646 716 1.7e-9 PFAM
Pfam:Collagen 697 760 1.6e-10 PFAM
Pfam:Collagen 785 848 3.1e-11 PFAM
low complexity region 878 899 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000088349
SMART Domains Protein: ENSMUSP00000085687
Gene: ENSMUSG00000026147

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
Pfam:Collagen 24 85 1.5e-11 PFAM
Pfam:Collagen 66 117 2.7e-9 PFAM
Pfam:Collagen 115 168 2.8e-8 PFAM
Pfam:Collagen 174 231 5.5e-11 PFAM
Pfam:Collagen 213 274 1.9e-11 PFAM
low complexity region 353 391 N/A INTRINSIC
Pfam:Collagen 405 479 1.3e-9 PFAM
Pfam:Collagen 456 519 1e-10 PFAM
Pfam:Collagen 544 607 2.4e-11 PFAM
low complexity region 637 658 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000088349
SMART Domains Protein: ENSMUSP00000085687
Gene: ENSMUSG00000026147

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
Pfam:Collagen 24 85 1.5e-11 PFAM
Pfam:Collagen 66 117 2.7e-9 PFAM
Pfam:Collagen 115 168 2.8e-8 PFAM
Pfam:Collagen 174 231 5.5e-11 PFAM
Pfam:Collagen 213 274 1.9e-11 PFAM
low complexity region 353 391 N/A INTRINSIC
Pfam:Collagen 405 479 1.3e-9 PFAM
Pfam:Collagen 456 519 1e-10 PFAM
Pfam:Collagen 544 607 2.4e-11 PFAM
low complexity region 637 658 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000088349
SMART Domains Protein: ENSMUSP00000085687
Gene: ENSMUSG00000026147

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
Pfam:Collagen 24 85 1.5e-11 PFAM
Pfam:Collagen 66 117 2.7e-9 PFAM
Pfam:Collagen 115 168 2.8e-8 PFAM
Pfam:Collagen 174 231 5.5e-11 PFAM
Pfam:Collagen 213 274 1.9e-11 PFAM
low complexity region 353 391 N/A INTRINSIC
Pfam:Collagen 405 479 1.3e-9 PFAM
Pfam:Collagen 456 519 1e-10 PFAM
Pfam:Collagen 544 607 2.4e-11 PFAM
low complexity region 637 658 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000088349
SMART Domains Protein: ENSMUSP00000085687
Gene: ENSMUSG00000026147

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
Pfam:Collagen 24 85 1.5e-11 PFAM
Pfam:Collagen 66 117 2.7e-9 PFAM
Pfam:Collagen 115 168 2.8e-8 PFAM
Pfam:Collagen 174 231 5.5e-11 PFAM
Pfam:Collagen 213 274 1.9e-11 PFAM
low complexity region 353 391 N/A INTRINSIC
Pfam:Collagen 405 479 1.3e-9 PFAM
Pfam:Collagen 456 519 1e-10 PFAM
Pfam:Collagen 544 607 2.4e-11 PFAM
low complexity region 637 658 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000088349
SMART Domains Protein: ENSMUSP00000085687
Gene: ENSMUSG00000026147

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
Pfam:Collagen 24 85 1.5e-11 PFAM
Pfam:Collagen 66 117 2.7e-9 PFAM
Pfam:Collagen 115 168 2.8e-8 PFAM
Pfam:Collagen 174 231 5.5e-11 PFAM
Pfam:Collagen 213 274 1.9e-11 PFAM
low complexity region 353 391 N/A INTRINSIC
Pfam:Collagen 405 479 1.3e-9 PFAM
Pfam:Collagen 456 519 1e-10 PFAM
Pfam:Collagen 544 607 2.4e-11 PFAM
low complexity region 637 658 N/A INTRINSIC
Meta Mutation Damage Score 0.9474 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, which is a minor (5-20%) collagen component of hyaline cartilage. Type IX collagen is usually found in tissues containing type II collagen, a fibrillar collagen. Studies in knockout mice have shown that synthesis of the alpha 1 chain is essential for assembly of type IX collagen molecules, a heterotrimeric molecule, and that lack of type IX collagen is associated with early onset osteoarthritis. Mutations in this gene are associated with osteoarthritis in humans, with multiple epiphyseal dysplasia, 6, a form of chondrodysplasia, and with Stickler syndrome, a disease characterized by ophthalmic, orofacial, articular, and auditory defects. Two transcript variants that encode different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted mutation show no conspicuous skeletal abnormalities at birth but develop early-onset degenerative joint disease resembling osteoarthritis as well as progressive hearing loss; restoration and remodeling of trabecular bone is perturbed with minimal effects on cortical bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp A G 9: 104,324,218 probably benign Het
Ankrd17 T A 5: 90,244,406 K1693* probably null Het
Car10 G A 11: 93,490,597 E129K possibly damaging Het
Ccnd1 A C 7: 144,939,665 V10G probably benign Het
Cd19 T C 7: 126,410,862 D406G probably damaging Het
Col4a1 G A 8: 11,218,713 P1009L probably damaging Het
Crlf3 A T 11: 80,056,601 probably benign Het
Dock3 A C 9: 106,911,486 probably benign Het
Dus1l A T 11: 120,792,808 probably benign Het
Dvl2 G A 11: 70,008,100 E438K probably damaging Het
Eif3g A G 9: 20,897,753 F85S probably damaging Het
Fam234b A G 6: 135,227,226 M456V probably benign Het
Fbxo47 G A 11: 97,857,655 probably benign Het
Galntl5 A G 5: 25,186,072 probably null Het
Gm11437 T C 11: 84,148,636 T288A possibly damaging Het
Gm5546 T A 3: 104,353,132 noncoding transcript Het
Gmfb C A 14: 46,817,455 A11S probably benign Het
Hnrnpa3 G T 2: 75,661,696 R52L probably damaging Het
Ing3 T C 6: 21,952,171 M48T probably benign Het
Kmt2a A G 9: 44,830,059 probably benign Het
Maats1 G A 16: 38,302,684 Q661* probably null Het
Megf8 G A 7: 25,353,958 probably null Het
Pex3 A G 10: 13,535,594 V180A probably benign Het
Pou6f1 G A 15: 100,587,836 Q106* probably null Het
Ror2 T C 13: 53,113,074 M442V probably benign Het
Rspo1 G A 4: 124,991,397 R22Q probably benign Het
Sec1 A G 7: 45,678,891 V244A probably damaging Het
Serac1 A G 17: 6,064,937 probably benign Het
Sgcz A G 8: 37,545,442 probably benign Het
Slc16a7 A T 10: 125,228,070 V466D probably benign Het
Tbl1xr1 T A 3: 22,189,785 D74E probably benign Het
Ube3b G T 5: 114,408,217 probably null Het
Ugt2b37 A G 5: 87,254,221 S184P probably benign Het
Other mutations in Col9a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Col9a1 APN 1 24185225 missense unknown
IGL00517:Col9a1 APN 1 24195534 intron probably benign
IGL01125:Col9a1 APN 1 24224645 critical splice acceptor site probably null
IGL01505:Col9a1 APN 1 24185124 missense unknown
IGL01583:Col9a1 APN 1 24185144 missense unknown
IGL01627:Col9a1 APN 1 24179608 critical splice donor site probably null
IGL01773:Col9a1 APN 1 24205066 missense probably benign 0.17
IGL02117:Col9a1 APN 1 24237493 nonsense probably null
IGL02192:Col9a1 APN 1 24221987 missense probably damaging 1.00
IGL02346:Col9a1 APN 1 24223609 missense probably damaging 0.96
IGL02383:Col9a1 APN 1 24185258 missense unknown
IGL02453:Col9a1 APN 1 24179357 missense unknown
IGL02553:Col9a1 APN 1 24221937 splice site probably benign
IGL03412:Col9a1 APN 1 24210427 critical splice donor site probably null
IGL03493:Col9a1 APN 1 24221570 splice site probably benign
ANU74:Col9a1 UTSW 1 24185328 missense unknown
R0076:Col9a1 UTSW 1 24237497 critical splice donor site probably null
R0090:Col9a1 UTSW 1 24223562 splice site probably null
R0356:Col9a1 UTSW 1 24185247 nonsense probably null
R0562:Col9a1 UTSW 1 24179279 splice site probably null
R0584:Col9a1 UTSW 1 24224490 splice site probably benign
R0708:Col9a1 UTSW 1 24237261 missense possibly damaging 0.92
R1342:Col9a1 UTSW 1 24223620 critical splice donor site probably null
R1445:Col9a1 UTSW 1 24237498 critical splice donor site probably null
R1791:Col9a1 UTSW 1 24185305 missense unknown
R1938:Col9a1 UTSW 1 24222473 missense probably damaging 1.00
R2214:Col9a1 UTSW 1 24208202 missense probably damaging 1.00
R2240:Col9a1 UTSW 1 24179501 missense unknown
R3757:Col9a1 UTSW 1 24232231 critical splice donor site probably null
R3891:Col9a1 UTSW 1 24185436 critical splice donor site probably null
R4249:Col9a1 UTSW 1 24244381 missense probably damaging 1.00
R4690:Col9a1 UTSW 1 24224706 splice site probably null
R4918:Col9a1 UTSW 1 24237258 missense possibly damaging 0.74
R4988:Col9a1 UTSW 1 24185192 missense unknown
R5144:Col9a1 UTSW 1 24239353 missense probably benign 0.08
R5327:Col9a1 UTSW 1 24195539 critical splice donor site probably null
R5511:Col9a1 UTSW 1 24179538 missense unknown
R5519:Col9a1 UTSW 1 24230254 splice site probably null
R5564:Col9a1 UTSW 1 24195355 start gained probably benign
R6076:Col9a1 UTSW 1 24195376 start gained probably benign
R6478:Col9a1 UTSW 1 24185405 missense unknown
R6886:Col9a1 UTSW 1 24185345 missense unknown
R7177:Col9a1 UTSW 1 24195417 missense unknown
R7259:Col9a1 UTSW 1 24185343 missense unknown
R7268:Col9a1 UTSW 1 24207398 missense possibly damaging 0.89
R7347:Col9a1 UTSW 1 24179403 intron probably null
R7644:Col9a1 UTSW 1 24185162 missense unknown
Predicted Primers PCR Primer
(F):5'- ATTGGTAGCCCCACCAATCTCAGC -3'
(R):5'- GCCTGAGGACAATGCCAGATACAC -3'

Sequencing Primer
(F):5'- GCCAAGTGGAAAACTGTCTC -3'
(R):5'- AAGTTACCCTCCCTGTTGGAATTG -3'
Posted On2014-07-09