Incidental Mutation 'R0076:Fam234b'
ID212552
Institutional Source Beutler Lab
Gene Symbol Fam234b
Ensembl Gene ENSMUSG00000030207
Gene Namefamily with sequence similarity 234, member B
Synonyms8430419L09Rik
MMRRC Submission 038363-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R0076 (G1)
Quality Score35
Status Validated
Chromosome6
Chromosomal Location135197977-135244955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135227226 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 456 (M456V)
Ref Sequence ENSEMBL: ENSMUSP00000107547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111915] [ENSMUST00000111916]
Predicted Effect probably benign
Transcript: ENSMUST00000111915
AA Change: M456V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000107546
Gene: ENSMUSG00000030207
AA Change: M456V

DomainStartEndE-ValueType
transmembrane domain 105 127 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 521 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111916
AA Change: M456V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000107547
Gene: ENSMUSG00000030207
AA Change: M456V

DomainStartEndE-ValueType
transmembrane domain 105 127 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 521 528 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151951
Meta Mutation Damage Score 0.0602 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp A G 9: 104,324,218 probably benign Het
Ankrd17 T A 5: 90,244,406 K1693* probably null Het
Car10 G A 11: 93,490,597 E129K possibly damaging Het
Ccnd1 A C 7: 144,939,665 V10G probably benign Het
Cd19 T C 7: 126,410,862 D406G probably damaging Het
Col4a1 G A 8: 11,218,713 P1009L probably damaging Het
Col9a1 G A 1: 24,237,497 probably null Het
Crlf3 A T 11: 80,056,601 probably benign Het
Dock3 A C 9: 106,911,486 probably benign Het
Dus1l A T 11: 120,792,808 probably benign Het
Dvl2 G A 11: 70,008,100 E438K probably damaging Het
Eif3g A G 9: 20,897,753 F85S probably damaging Het
Fbxo47 G A 11: 97,857,655 probably benign Het
Galntl5 A G 5: 25,186,072 probably null Het
Gm11437 T C 11: 84,148,636 T288A possibly damaging Het
Gm5546 T A 3: 104,353,132 noncoding transcript Het
Gmfb C A 14: 46,817,455 A11S probably benign Het
Hnrnpa3 G T 2: 75,661,696 R52L probably damaging Het
Ing3 T C 6: 21,952,171 M48T probably benign Het
Kmt2a A G 9: 44,830,059 probably benign Het
Maats1 G A 16: 38,302,684 Q661* probably null Het
Megf8 G A 7: 25,353,958 probably null Het
Pex3 A G 10: 13,535,594 V180A probably benign Het
Pou6f1 G A 15: 100,587,836 Q106* probably null Het
Ror2 T C 13: 53,113,074 M442V probably benign Het
Rspo1 G A 4: 124,991,397 R22Q probably benign Het
Sec1 A G 7: 45,678,891 V244A probably damaging Het
Serac1 A G 17: 6,064,937 probably benign Het
Sgcz A G 8: 37,545,442 probably benign Het
Slc16a7 A T 10: 125,228,070 V466D probably benign Het
Tbl1xr1 T A 3: 22,189,785 D74E probably benign Het
Ube3b G T 5: 114,408,217 probably null Het
Ugt2b37 A G 5: 87,254,221 S184P probably benign Het
Other mutations in Fam234b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00536:Fam234b APN 6 135225204 missense probably damaging 1.00
IGL01020:Fam234b APN 6 135211906 missense probably benign 0.13
IGL01731:Fam234b APN 6 135211905 missense possibly damaging 0.90
IGL01994:Fam234b APN 6 135225205 nonsense probably null
IGL02010:Fam234b APN 6 135209407 missense probably benign 0.17
IGL02071:Fam234b APN 6 135227151 critical splice acceptor site probably null
IGL02340:Fam234b APN 6 135231661 missense probably damaging 1.00
IGL02869:Fam234b APN 6 135225203 missense probably damaging 1.00
R0076:Fam234b UTSW 6 135227226 missense probably benign 0.00
R0123:Fam234b UTSW 6 135217074 missense possibly damaging 0.46
R0127:Fam234b UTSW 6 135218823 splice site probably benign
R0225:Fam234b UTSW 6 135217074 missense possibly damaging 0.46
R0570:Fam234b UTSW 6 135209249 missense probably benign 0.00
R0705:Fam234b UTSW 6 135227215 missense probably benign 0.11
R1140:Fam234b UTSW 6 135225758 missense probably benign 0.00
R1446:Fam234b UTSW 6 135209330 splice site probably null
R1464:Fam234b UTSW 6 135228492 missense probably benign 0.00
R1464:Fam234b UTSW 6 135228492 missense probably benign 0.00
R2044:Fam234b UTSW 6 135226914 missense probably benign 0.04
R2350:Fam234b UTSW 6 135231724 missense probably damaging 1.00
R3914:Fam234b UTSW 6 135225683 missense probably damaging 1.00
R4261:Fam234b UTSW 6 135209136 missense unknown
R5102:Fam234b UTSW 6 135209284 missense probably benign 0.03
R5133:Fam234b UTSW 6 135209195 missense probably benign 0.01
R5313:Fam234b UTSW 6 135209187 missense possibly damaging 0.56
R5375:Fam234b UTSW 6 135233357 missense probably damaging 1.00
R5418:Fam234b UTSW 6 135226968 missense probably benign 0.00
R5838:Fam234b UTSW 6 135225267 missense probably benign 0.00
R5953:Fam234b UTSW 6 135225707 missense possibly damaging 0.95
R6737:Fam234b UTSW 6 135228515 missense probably damaging 0.99
R7056:Fam234b UTSW 6 135228452 missense probably benign 0.32
R7221:Fam234b UTSW 6 135228531 missense probably damaging 1.00
R7418:Fam234b UTSW 6 135217011 missense probably benign 0.04
R7459:Fam234b UTSW 6 135211901 missense probably benign 0.04
R7599:Fam234b UTSW 6 135226876 missense probably damaging 1.00
R7602:Fam234b UTSW 6 135225243 missense possibly damaging 0.79
R7639:Fam234b UTSW 6 135225800 splice site probably null
R7748:Fam234b UTSW 6 135209351 missense probably damaging 1.00
R7773:Fam234b UTSW 6 135243914 missense probably benign 0.01
R8544:Fam234b UTSW 6 135233289 missense probably damaging 1.00
Z1177:Fam234b UTSW 6 135198008 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCTGCTGTTCTGAGCAACTTTCCTG -3'
(R):5'- TGTACGGTGATTCCTCCCACCTAAC -3'

Sequencing Primer
(F):5'- CTGCTTGTTACCGTGGCTG -3'
(R):5'- CTAACTGGAAGTATAGGCTCCC -3'
Posted On2014-07-09