Incidental Mutation 'R0076:Serac1'
ID 212566
Institutional Source Beutler Lab
Gene Symbol Serac1
Ensembl Gene ENSMUSG00000015659
Gene Name serine active site containing 1
Synonyms 4930511N22Rik, D17Ertd141e
MMRRC Submission 038363-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0076 (G1)
Quality Score 69
Status Validated
Chromosome 17
Chromosomal Location 6042196-6079741 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 6064937 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024570] [ENSMUST00000097432]
AlphaFold Q3U213
Predicted Effect probably benign
Transcript: ENSMUST00000024570
SMART Domains Protein: ENSMUSP00000024570
Gene: ENSMUSG00000015659

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
low complexity region 161 169 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
SCOP:d1jdha_ 243 336 3e-5 SMART
Pfam:PGAP1 360 519 3.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097432
SMART Domains Protein: ENSMUSP00000095043
Gene: ENSMUSG00000015659

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
SCOP:d1gw5a_ 89 464 3e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139542
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a phosphatidylglycerol remodeling protein found at the interface of mitochondria and endoplasmic reticula, where it mediates phospholipid exchange. The encoded protein plays a major role in mitochondrial function and intracellular cholesterol trafficking. Defects in this gene are a cause of 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome (MEGDEL). Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp A G 9: 104,324,218 probably benign Het
Ankrd17 T A 5: 90,244,406 K1693* probably null Het
Car10 G A 11: 93,490,597 E129K possibly damaging Het
Ccnd1 A C 7: 144,939,665 V10G probably benign Het
Cd19 T C 7: 126,410,862 D406G probably damaging Het
Col4a1 G A 8: 11,218,713 P1009L probably damaging Het
Col9a1 G A 1: 24,237,497 probably null Het
Crlf3 A T 11: 80,056,601 probably benign Het
Dock3 A C 9: 106,911,486 probably benign Het
Dus1l A T 11: 120,792,808 probably benign Het
Dvl2 G A 11: 70,008,100 E438K probably damaging Het
Eif3g A G 9: 20,897,753 F85S probably damaging Het
Fam234b A G 6: 135,227,226 M456V probably benign Het
Fbxo47 G A 11: 97,857,655 probably benign Het
Galntl5 A G 5: 25,186,072 probably null Het
Gm11437 T C 11: 84,148,636 T288A possibly damaging Het
Gm5546 T A 3: 104,353,132 noncoding transcript Het
Gmfb C A 14: 46,817,455 A11S probably benign Het
Hnrnpa3 G T 2: 75,661,696 R52L probably damaging Het
Ing3 T C 6: 21,952,171 M48T probably benign Het
Kmt2a A G 9: 44,830,059 probably benign Het
Maats1 G A 16: 38,302,684 Q661* probably null Het
Megf8 G A 7: 25,353,958 probably null Het
Pex3 A G 10: 13,535,594 V180A probably benign Het
Pou6f1 G A 15: 100,587,836 Q106* probably null Het
Ror2 T C 13: 53,113,074 M442V probably benign Het
Rspo1 G A 4: 124,991,397 R22Q probably benign Het
Sec1 A G 7: 45,678,891 V244A probably damaging Het
Sgcz A G 8: 37,545,442 probably benign Het
Slc16a7 A T 10: 125,228,070 V466D probably benign Het
Tbl1xr1 T A 3: 22,189,785 D74E probably benign Het
Ube3b G T 5: 114,408,217 probably null Het
Ugt2b37 A G 5: 87,254,221 S184P probably benign Het
Other mutations in Serac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Serac1 APN 17 6074253 splice site probably benign
IGL02642:Serac1 APN 17 6045746 missense possibly damaging 0.56
IGL02972:Serac1 APN 17 6070764 nonsense probably null
FR4304:Serac1 UTSW 17 6070808 missense probably damaging 1.00
FR4340:Serac1 UTSW 17 6070808 missense probably damaging 1.00
FR4342:Serac1 UTSW 17 6070808 missense probably damaging 1.00
FR4589:Serac1 UTSW 17 6070808 missense probably damaging 1.00
PIT4480001:Serac1 UTSW 17 6050812 missense probably damaging 1.00
R0076:Serac1 UTSW 17 6064937 splice site probably benign
R0127:Serac1 UTSW 17 6048840 missense probably damaging 1.00
R0211:Serac1 UTSW 17 6050060 missense possibly damaging 0.67
R0245:Serac1 UTSW 17 6051756 missense probably damaging 1.00
R0538:Serac1 UTSW 17 6048826 splice site probably benign
R0652:Serac1 UTSW 17 6051756 missense probably damaging 1.00
R0988:Serac1 UTSW 17 6061580 missense probably benign 0.02
R1965:Serac1 UTSW 17 6048999 missense possibly damaging 0.72
R1984:Serac1 UTSW 17 6045689 splice site probably null
R2145:Serac1 UTSW 17 6050785 missense probably damaging 1.00
R3426:Serac1 UTSW 17 6066778 missense probably benign 0.04
R3921:Serac1 UTSW 17 6066792 missense probably damaging 1.00
R4760:Serac1 UTSW 17 6051790 missense possibly damaging 0.69
R4958:Serac1 UTSW 17 6069382 missense probably benign 0.15
R5552:Serac1 UTSW 17 6056692 nonsense probably null
R5874:Serac1 UTSW 17 6043913 unclassified probably benign
R5964:Serac1 UTSW 17 6065049 missense probably benign
R6614:Serac1 UTSW 17 6045662 missense probably damaging 1.00
R6794:Serac1 UTSW 17 6051710 missense probably damaging 1.00
R6949:Serac1 UTSW 17 6051815 missense probably damaging 1.00
R7157:Serac1 UTSW 17 6074201 missense probably benign
R7161:Serac1 UTSW 17 6065076 missense probably damaging 0.97
R7426:Serac1 UTSW 17 6069314 missense probably damaging 1.00
R8270:Serac1 UTSW 17 6050758 missense probably damaging 1.00
R8733:Serac1 UTSW 17 6050028 missense probably damaging 1.00
R8785:Serac1 UTSW 17 6044202 missense probably damaging 0.99
R9057:Serac1 UTSW 17 6061615 missense probably damaging 0.98
R9657:Serac1 UTSW 17 6069383 missense probably benign 0.04
Z1088:Serac1 UTSW 17 6048918 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGTCCAAATAGCCGTATCAGCTC -3'
(R):5'- TTCCAGGACTCCTCCACTGAAGAG -3'

Sequencing Primer
(F):5'- caagccctccgtcactg -3'
(R):5'- AGGAACTCAGGCATCTGCTG -3'
Posted On 2014-07-09