Incidental Mutation 'R1917:Adgre5'
ID212611
Institutional Source Beutler Lab
Gene Symbol Adgre5
Ensembl Gene ENSMUSG00000002885
Gene Nameadhesion G protein-coupled receptor E5
SynonymsCd97, EGF-TM7 receptor
MMRRC Submission 039935-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1917 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location83723251-83741326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83729109 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 190 (V190A)
Ref Sequence ENSEMBL: ENSMUSP00000128220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002964] [ENSMUST00000075843] [ENSMUST00000109802] [ENSMUST00000149368] [ENSMUST00000166939] [ENSMUST00000172396] [ENSMUST00000212949]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002964
AA Change: V192A

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000002964
Gene: ENSMUSG00000002885
AA Change: V192A

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 120 167 1.78e-11 SMART
GPS 384 430 2.18e-8 SMART
Pfam:Dicty_CAR 431 703 1.3e-8 PFAM
Pfam:7tm_2 432 672 8.1e-68 PFAM
low complexity region 704 714 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075843
AA Change: V286A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075240
Gene: ENSMUSG00000002885
AA Change: V286A

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 165 213 1.38e-8 SMART
EGF_CA 214 261 1.78e-11 SMART
GPS 478 524 2.18e-8 SMART
Pfam:Dicty_CAR 525 798 4.6e-8 PFAM
Pfam:7tm_2 526 766 5.3e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109802
AA Change: V241A

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105427
Gene: ENSMUSG00000002885
AA Change: V241A

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 120 168 1.38e-8 SMART
EGF_CA 169 216 1.78e-11 SMART
GPS 433 479 2.18e-8 SMART
Pfam:Dicty_CAR 480 752 5.3e-8 PFAM
Pfam:7tm_2 481 721 7.5e-67 PFAM
low complexity region 753 763 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140606
Predicted Effect probably benign
Transcript: ENSMUST00000149368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154075
Predicted Effect probably damaging
Transcript: ENSMUST00000166939
AA Change: V190A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128220
Gene: ENSMUSG00000002885
AA Change: V190A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
EGF 28 66 1.63e1 SMART
EGF_CA 67 117 5.92e-8 SMART
EGF_CA 118 165 1.78e-11 SMART
GPS 382 428 2.18e-8 SMART
Pfam:Dicty_CAR 429 701 2.1e-7 PFAM
Pfam:7tm_2 430 670 1.7e-66 PFAM
low complexity region 702 712 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172396
SMART Domains Protein: ENSMUSP00000132222
Gene: ENSMUSG00000005481

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 264 4.06e-54 SMART
HELICc 300 381 9.09e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212949
Meta Mutation Damage Score 0.6338 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.8%
  • 20x: 93.6%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the EGF-TM7 subfamily of adhesion G protein-coupled receptors, which mediate cell-cell interactions. These proteins are cleaved by self-catalytic proteolysis into a large extracellular subunit and seven-span transmembrane subunit, which associate at the cell surface as a receptor complex. The encoded protein may play a role in cell adhesion as well as leukocyte recruitment, activation and migration, and contains multiple extracellular EGF-like repeats which mediate binding to chondroitin sulfate and the cell surface complement regulatory protein CD55. Expression of this gene may play a role in the progression of several types of cancer. Alternatively spliced transcript variants encoding multiple isoforms with 3 to 5 EGF-like repeats have been observed for this gene. This gene is found in a cluster with other EGF-TM7 genes on the short arm of chromosome 19. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype apart from mild granulocytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik A G 11: 29,824,039 S473P probably benign Het
Abca8a A G 11: 110,091,515 probably benign Het
Akap6 A G 12: 53,104,612 N1153S probably benign Het
Aldh1a7 G A 19: 20,727,455 H20Y probably benign Het
B430306N03Rik A G 17: 48,324,148 E278G probably benign Het
Cacna1b C A 2: 24,616,879 R72L probably null Het
Cc2d2a C G 5: 43,706,222 S675R probably damaging Het
Ccdc88b T A 19: 6,849,226 E1040D probably damaging Het
Cmtm7 A G 9: 114,763,364 V55A probably damaging Het
Coq4 A C 2: 29,789,926 T77P probably damaging Het
Cyp2j11 C A 4: 96,339,974 W136L probably damaging Het
Dctn2 T A 10: 127,275,049 Y86* probably null Het
Ddx56 A G 11: 6,263,937 probably null Het
Dopey2 T C 16: 93,716,262 S30P probably damaging Het
Ep400 T C 5: 110,703,575 K1347R unknown Het
Fat3 T A 9: 15,997,057 T2550S possibly damaging Het
Fcrla G T 1: 170,927,526 C5* probably null Het
Fermt1 T A 2: 132,922,842 D365V probably damaging Het
Fhod3 A G 18: 24,989,965 probably benign Het
Fhod3 A G 18: 25,085,601 D807G probably benign Het
Fnip1 C T 11: 54,480,684 T177I probably damaging Het
Gart T C 16: 91,628,149 Y662C probably damaging Het
Gda A T 19: 21,397,640 probably benign Het
Gk A G X: 85,760,580 I85T probably damaging Het
Gm12169 A G 11: 46,528,531 D58G possibly damaging Het
Gm14548 C T 7: 3,897,638 V38M probably damaging Het
Gm3476 A G 14: 6,118,358 L255P possibly damaging Het
Gm9966 T C 7: 95,958,477 C2R unknown Het
Gnpda1 T C 18: 38,333,190 probably null Het
Gtf2h4 G A 17: 35,670,198 L246F possibly damaging Het
Hao1 A T 2: 134,523,060 S216T probably benign Het
Hnrnpr C A 4: 136,332,488 S301* probably null Het
Hsd3b2 A G 3: 98,712,026 I201T probably benign Het
Jade2 T C 11: 51,818,538 E548G possibly damaging Het
Katnbl1 T C 2: 112,409,179 I241T probably benign Het
Keap1 G T 9: 21,233,806 Q299K probably benign Het
Kif1a T C 1: 93,019,031 I1650V possibly damaging Het
Lrba G A 3: 86,664,501 G275R probably damaging Het
Map3k9 C A 12: 81,780,790 E29* probably null Het
Mat1a G A 14: 41,121,437 V307I probably damaging Het
Mcm2 A T 6: 88,891,803 M324K possibly damaging Het
Metap1d T C 2: 71,511,527 V155A probably damaging Het
Mtbp A G 15: 55,564,677 probably benign Het
Myh14 T C 7: 44,657,925 T231A probably benign Het
Mylk4 A T 13: 32,724,853 D90E probably benign Het
Myo15b T A 11: 115,882,254 I1837K possibly damaging Het
Myo3a T A 2: 22,291,922 H242Q probably damaging Het
Nxn A G 11: 76,261,672 probably benign Het
Olfr791 T A 10: 129,527,049 V274D probably damaging Het
Pak3 C A X: 143,791,302 A553E possibly damaging Het
Pdia2 T A 17: 26,198,105 T122S possibly damaging Het
Plod2 A G 9: 92,581,257 T132A probably benign Het
Ptprz1 T A 6: 23,035,040 probably benign Het
Rad54b A C 4: 11,601,693 N416T probably damaging Het
Recql4 A T 15: 76,703,837 Y1142* probably null Het
Rnf216 A G 5: 142,992,806 V859A probably benign Het
Scnm1 G T 3: 95,130,273 P161T possibly damaging Het
Serpinb6b A G 13: 32,978,240 I222V probably benign Het
Serpinf1 A G 11: 75,411,007 I274T possibly damaging Het
Slc28a1 T C 7: 81,169,586 F641L probably benign Het
Slc8a2 A G 7: 16,152,920 I657V probably benign Het
Smchd1 A G 17: 71,407,237 I877T possibly damaging Het
Spata31 T C 13: 64,920,865 Y276H possibly damaging Het
Spire2 A G 8: 123,363,071 D447G probably benign Het
Stk3 G A 15: 35,073,217 T119I probably damaging Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Sult2a5 T C 7: 13,670,684 F282S probably damaging Het
Syk A T 13: 52,622,708 D248V probably damaging Het
Thoc6 C T 17: 23,669,390 probably benign Het
Tll2 T A 19: 41,128,497 D293V possibly damaging Het
Umodl1 G A 17: 30,984,043 V457M probably damaging Het
Usp19 T A 9: 108,499,325 C689* probably null Het
Usp24 T G 4: 106,410,286 V1955G probably damaging Het
Vmn1r226 T C 17: 20,687,580 S25P probably damaging Het
Vmn2r69 C T 7: 85,411,683 C231Y probably damaging Het
Wdr73 C T 7: 80,893,333 D176N probably benign Het
Wnt7b T A 15: 85,559,080 I41F probably damaging Het
Zfhx3 T C 8: 108,956,248 S3440P unknown Het
Zfp52 T G 17: 21,560,164 N91K probably benign Het
Zfp930 C A 8: 69,228,705 Q350K probably benign Het
Zfp949 T C 9: 88,570,062 S562P probably damaging Het
Other mutations in Adgre5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Adgre5 APN 8 83728401 missense probably benign 0.01
IGL01365:Adgre5 APN 8 83723889 intron probably null
IGL01661:Adgre5 APN 8 83727935 missense probably damaging 0.99
IGL01707:Adgre5 APN 8 83724347 missense probably damaging 1.00
IGL01760:Adgre5 APN 8 83731957 missense probably benign 0.02
IGL02207:Adgre5 APN 8 83728284 missense probably damaging 1.00
IGL02483:Adgre5 APN 8 83725253 missense probably damaging 1.00
IGL03194:Adgre5 APN 8 83734018 missense possibly damaging 0.67
PIT4453001:Adgre5 UTSW 8 83724460 missense probably benign 0.08
R0024:Adgre5 UTSW 8 83728284 missense probably damaging 1.00
R0137:Adgre5 UTSW 8 83724898 missense probably damaging 1.00
R0257:Adgre5 UTSW 8 83731995 missense possibly damaging 0.54
R0485:Adgre5 UTSW 8 83731998 missense probably damaging 0.99
R0522:Adgre5 UTSW 8 83730176 missense probably benign 0.30
R0940:Adgre5 UTSW 8 83733497 missense probably damaging 1.00
R1372:Adgre5 UTSW 8 83728320 missense probably damaging 0.96
R1617:Adgre5 UTSW 8 83730177 missense possibly damaging 0.50
R1679:Adgre5 UTSW 8 83729405 missense probably benign 0.09
R1918:Adgre5 UTSW 8 83729109 missense probably damaging 0.99
R2072:Adgre5 UTSW 8 83727804 missense probably benign 0.24
R2831:Adgre5 UTSW 8 83728394 missense possibly damaging 0.80
R5250:Adgre5 UTSW 8 83733440 missense probably benign
R5512:Adgre5 UTSW 8 83729086 missense probably benign
R6077:Adgre5 UTSW 8 83727966 missense probably benign
R7486:Adgre5 UTSW 8 83723886 missense probably damaging 1.00
R7733:Adgre5 UTSW 8 83729396 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCATTATAACCCTTGTGTAGTAGCC -3'
(R):5'- ACCGTTCCCTACTTGGACAC -3'

Sequencing Primer
(F):5'- ATGGCTGCACATGTCAGATC -3'
(R):5'- ACTTGGACACTGCTGCC -3'
Posted On2014-07-14