Incidental Mutation 'R1917:Stxbp5'
ID212619
Institutional Source Beutler Lab
Gene Symbol Stxbp5
Ensembl Gene ENSMUSG00000019790
Gene Namesyntaxin binding protein 5 (tomosyn)
Synonyms4930565N16Rik, 0710001E20Rik, LGL3, tomosyn 1
MMRRC Submission 039935-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1917 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location9755547-9901079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 9812298 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 420 (V420F)
Ref Sequence ENSEMBL: ENSMUSP00000044535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038213] [ENSMUST00000125200] [ENSMUST00000141722]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038213
AA Change: V420F

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044535
Gene: ENSMUSG00000019790
AA Change: V420F

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 276 385 2e-36 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
Pfam:Lgl_C 771 1050 2.7e-8 PFAM
PDB:1URQ|A 1086 1145 2e-33 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000125200
AA Change: V420F

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121507
Gene: ENSMUSG00000019790
AA Change: V420F

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.6e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 722 730 N/A INTRINSIC
Pfam:Lgl_C 839 994 1.9e-8 PFAM
PDB:1URQ|A 1033 1092 2e-33 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000141722
AA Change: V420F

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123253
Gene: ENSMUSG00000019790
AA Change: V420F

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.7e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 739 747 N/A INTRINSIC
Pfam:Lgl_C 856 1011 2e-8 PFAM
PDB:1URQ|A 1050 1109 2e-33 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219200
Meta Mutation Damage Score 0.4019 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.8%
  • 20x: 93.6%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntaxin 1 is a component of the 7S and 20S SNARE complexes which are involved in docking and fusion of synaptic vesicles with the presynaptic plasma membrane. This gene encodes a syntaxin 1 binding protein. In rat, a similar protein dissociates syntaxin 1 from the Munc18/n-Sec1/rbSec1 complex to form a 10S complex, an intermediate which can be converted to the 7S SNARE complex. Thus this protein is thought to be involved in neurotransmitter release by stimulating SNARE complex formation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some background sensitive prenatal lethality and increased synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik A G 11: 29,824,039 S473P probably benign Het
Abca8a A G 11: 110,091,515 probably benign Het
Adgre5 A G 8: 83,729,109 V190A probably damaging Het
Akap6 A G 12: 53,104,612 N1153S probably benign Het
Aldh1a7 G A 19: 20,727,455 H20Y probably benign Het
B430306N03Rik A G 17: 48,324,148 E278G probably benign Het
Cacna1b C A 2: 24,616,879 R72L probably null Het
Cc2d2a C G 5: 43,706,222 S675R probably damaging Het
Ccdc88b T A 19: 6,849,226 E1040D probably damaging Het
Cmtm7 A G 9: 114,763,364 V55A probably damaging Het
Coq4 A C 2: 29,789,926 T77P probably damaging Het
Cyp2j11 C A 4: 96,339,974 W136L probably damaging Het
Dctn2 T A 10: 127,275,049 Y86* probably null Het
Ddx56 A G 11: 6,263,937 probably null Het
Dopey2 T C 16: 93,716,262 S30P probably damaging Het
Ep400 T C 5: 110,703,575 K1347R unknown Het
Fat3 T A 9: 15,997,057 T2550S possibly damaging Het
Fcrla G T 1: 170,927,526 C5* probably null Het
Fermt1 T A 2: 132,922,842 D365V probably damaging Het
Fhod3 A G 18: 24,989,965 probably benign Het
Fhod3 A G 18: 25,085,601 D807G probably benign Het
Fnip1 C T 11: 54,480,684 T177I probably damaging Het
Gart T C 16: 91,628,149 Y662C probably damaging Het
Gda A T 19: 21,397,640 probably benign Het
Gk A G X: 85,760,580 I85T probably damaging Het
Gm12169 A G 11: 46,528,531 D58G possibly damaging Het
Gm14548 C T 7: 3,897,638 V38M probably damaging Het
Gm3476 A G 14: 6,118,358 L255P possibly damaging Het
Gm9966 T C 7: 95,958,477 C2R unknown Het
Gnpda1 T C 18: 38,333,190 probably null Het
Gtf2h4 G A 17: 35,670,198 L246F possibly damaging Het
Hao1 A T 2: 134,523,060 S216T probably benign Het
Hnrnpr C A 4: 136,332,488 S301* probably null Het
Hsd3b2 A G 3: 98,712,026 I201T probably benign Het
Jade2 T C 11: 51,818,538 E548G possibly damaging Het
Katnbl1 T C 2: 112,409,179 I241T probably benign Het
Keap1 G T 9: 21,233,806 Q299K probably benign Het
Kif1a T C 1: 93,019,031 I1650V possibly damaging Het
Lrba G A 3: 86,664,501 G275R probably damaging Het
Map3k9 C A 12: 81,780,790 E29* probably null Het
Mat1a G A 14: 41,121,437 V307I probably damaging Het
Mcm2 A T 6: 88,891,803 M324K possibly damaging Het
Metap1d T C 2: 71,511,527 V155A probably damaging Het
Mtbp A G 15: 55,564,677 probably benign Het
Myh14 T C 7: 44,657,925 T231A probably benign Het
Mylk4 A T 13: 32,724,853 D90E probably benign Het
Myo15b T A 11: 115,882,254 I1837K possibly damaging Het
Myo3a T A 2: 22,291,922 H242Q probably damaging Het
Nxn A G 11: 76,261,672 probably benign Het
Olfr791 T A 10: 129,527,049 V274D probably damaging Het
Pak3 C A X: 143,791,302 A553E possibly damaging Het
Pdia2 T A 17: 26,198,105 T122S possibly damaging Het
Plod2 A G 9: 92,581,257 T132A probably benign Het
Ptprz1 T A 6: 23,035,040 probably benign Het
Rad54b A C 4: 11,601,693 N416T probably damaging Het
Recql4 A T 15: 76,703,837 Y1142* probably null Het
Rnf216 A G 5: 142,992,806 V859A probably benign Het
Scnm1 G T 3: 95,130,273 P161T possibly damaging Het
Serpinb6b A G 13: 32,978,240 I222V probably benign Het
Serpinf1 A G 11: 75,411,007 I274T possibly damaging Het
Slc28a1 T C 7: 81,169,586 F641L probably benign Het
Slc8a2 A G 7: 16,152,920 I657V probably benign Het
Smchd1 A G 17: 71,407,237 I877T possibly damaging Het
Spata31 T C 13: 64,920,865 Y276H possibly damaging Het
Spire2 A G 8: 123,363,071 D447G probably benign Het
Stk3 G A 15: 35,073,217 T119I probably damaging Het
Sult2a5 T C 7: 13,670,684 F282S probably damaging Het
Syk A T 13: 52,622,708 D248V probably damaging Het
Thoc6 C T 17: 23,669,390 probably benign Het
Tll2 T A 19: 41,128,497 D293V possibly damaging Het
Umodl1 G A 17: 30,984,043 V457M probably damaging Het
Usp19 T A 9: 108,499,325 C689* probably null Het
Usp24 T G 4: 106,410,286 V1955G probably damaging Het
Vmn1r226 T C 17: 20,687,580 S25P probably damaging Het
Vmn2r69 C T 7: 85,411,683 C231Y probably damaging Het
Wdr73 C T 7: 80,893,333 D176N probably benign Het
Wnt7b T A 15: 85,559,080 I41F probably damaging Het
Zfhx3 T C 8: 108,956,248 S3440P unknown Het
Zfp52 T G 17: 21,560,164 N91K probably benign Het
Zfp930 C A 8: 69,228,705 Q350K probably benign Het
Zfp949 T C 9: 88,570,062 S562P probably damaging Het
Other mutations in Stxbp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Stxbp5 APN 10 9799950 missense probably damaging 1.00
IGL00950:Stxbp5 APN 10 9808602 splice site probably benign
IGL01725:Stxbp5 APN 10 9817411 missense probably damaging 1.00
IGL02150:Stxbp5 APN 10 9762821 missense probably damaging 1.00
IGL02339:Stxbp5 APN 10 9816297 missense possibly damaging 0.89
IGL02697:Stxbp5 APN 10 9762956 nonsense probably null
IGL02720:Stxbp5 APN 10 9789361 critical splice donor site probably null
IGL03155:Stxbp5 APN 10 9816290 missense probably null 1.00
IGL03288:Stxbp5 APN 10 9866703 splice site probably null
Fatty_fish UTSW 10 9770551 missense probably damaging 1.00
reindeer UTSW 10 9838092 missense probably damaging 1.00
H8562:Stxbp5 UTSW 10 9769443 missense probably benign 0.36
PIT4544001:Stxbp5 UTSW 10 9817304 critical splice donor site probably null
R0025:Stxbp5 UTSW 10 9762748 missense probably damaging 1.00
R0025:Stxbp5 UTSW 10 9762748 missense probably damaging 1.00
R0219:Stxbp5 UTSW 10 9770528 missense probably benign 0.36
R0226:Stxbp5 UTSW 10 9866698 splice site probably benign
R0631:Stxbp5 UTSW 10 9784358 missense probably benign
R0723:Stxbp5 UTSW 10 9768873 missense probably damaging 1.00
R0833:Stxbp5 UTSW 10 9865099 missense probably damaging 1.00
R0836:Stxbp5 UTSW 10 9865099 missense probably damaging 1.00
R0863:Stxbp5 UTSW 10 9809040 missense possibly damaging 0.86
R1225:Stxbp5 UTSW 10 9812391 missense possibly damaging 0.94
R1271:Stxbp5 UTSW 10 9816269 missense probably damaging 1.00
R1536:Stxbp5 UTSW 10 9838092 missense probably damaging 1.00
R1852:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1884:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1902:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1918:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R2174:Stxbp5 UTSW 10 9835846 missense possibly damaging 0.69
R3773:Stxbp5 UTSW 10 9768927 missense probably damaging 1.00
R3901:Stxbp5 UTSW 10 9769419 missense probably damaging 1.00
R3981:Stxbp5 UTSW 10 9789316 intron probably benign
R4572:Stxbp5 UTSW 10 9838144 missense probably damaging 0.99
R4764:Stxbp5 UTSW 10 9770623 missense probably damaging 1.00
R4841:Stxbp5 UTSW 10 9762891 missense probably benign 0.06
R4842:Stxbp5 UTSW 10 9762891 missense probably benign 0.06
R4884:Stxbp5 UTSW 10 9812341 nonsense probably null
R4887:Stxbp5 UTSW 10 9809100 missense probably benign
R4930:Stxbp5 UTSW 10 9760866 utr 3 prime probably benign
R5065:Stxbp5 UTSW 10 9770551 missense probably damaging 1.00
R5285:Stxbp5 UTSW 10 9798275 critical splice acceptor site probably null
R5306:Stxbp5 UTSW 10 9799991 missense probably damaging 1.00
R5455:Stxbp5 UTSW 10 9808508 missense probably benign
R5531:Stxbp5 UTSW 10 9762924 nonsense probably null
R5605:Stxbp5 UTSW 10 9769746 intron probably benign
R5614:Stxbp5 UTSW 10 9760894 utr 3 prime probably benign
R5805:Stxbp5 UTSW 10 9900586 missense probably benign
R5990:Stxbp5 UTSW 10 9835933 missense probably damaging 1.00
R6025:Stxbp5 UTSW 10 9800028 missense probably benign 0.00
R6056:Stxbp5 UTSW 10 9770686 missense probably benign 0.00
R6147:Stxbp5 UTSW 10 9808472 missense possibly damaging 0.93
R6194:Stxbp5 UTSW 10 9817339 missense probably damaging 0.99
R6284:Stxbp5 UTSW 10 9767179 missense probably benign 0.32
R6284:Stxbp5 UTSW 10 9767187 missense probably damaging 1.00
R6394:Stxbp5 UTSW 10 9899231 nonsense probably null
R6427:Stxbp5 UTSW 10 9899254 missense probably damaging 1.00
R6894:Stxbp5 UTSW 10 9784361 missense probably benign 0.00
R7229:Stxbp5 UTSW 10 9798187 missense probably damaging 1.00
R7337:Stxbp5 UTSW 10 9809130 missense possibly damaging 0.93
R7686:Stxbp5 UTSW 10 9769410 missense probably damaging 0.99
X0020:Stxbp5 UTSW 10 9762890 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- GCCCCAATTACCACCATTGATG -3'
(R):5'- AAACGCTTCACTGTTTTCACAC -3'

Sequencing Primer
(F):5'- GGTCTATTAGGAAGTTATGAACACAG -3'
(R):5'- ACGCTTCACTGTTTTCACACATTTAC -3'
Posted On2014-07-14