Mutagenetix > Incidental Mutations

Incidental Mutation 'R1917:Stxbp5'

212619

Institutional Source

Beutler Lab

Gene Symbol

Stxbp5

Ensembl Gene

ENSMUSG00000019790

Gene Name

syntaxin binding protein 5 (tomosyn)

Synonyms

4930565N16Rik, 0710001E20Rik, LGL3, tomosyn 1

MMRRC Submission

039935-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1917 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

9755547-9901079 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 9812298 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 420 (V420F)

Ref Sequence

ENSEMBL: ENSMUSP00000044535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038213] [ENSMUST00000125200] [ENSMUST00000141722]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038213
AA Change: V420F

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000044535
Gene: ENSMUSG00000019790
AA Change: V420F

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	276	385	2e-36	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	713	724	N/A	INTRINSIC
Pfam:Lgl_C	771	1050	2.7e-8	PFAM
PDB:1URQ\|A	1086	1145	2e-33	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000125200
AA Change: V420F

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000121507
Gene: ENSMUSG00000019790
AA Change: V420F

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	273	385	1.6e-46	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	722	730	N/A	INTRINSIC
Pfam:Lgl_C	839	994	1.9e-8	PFAM
PDB:1URQ\|A	1033	1092	2e-33	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000141722
AA Change: V420F

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000123253
Gene: ENSMUSG00000019790
AA Change: V420F

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	273	385	1.7e-46	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	739	747	N/A	INTRINSIC
Pfam:Lgl_C	856	1011	2e-8	PFAM
PDB:1URQ\|A	1050	1109	2e-33	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219200

Meta Mutation Damage Score

0.4019

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.8%
20x: 93.6%

Validation Efficiency

100% (83/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntaxin 1 is a component of the 7S and 20S SNARE complexes which are involved in docking and fusion of synaptic vesicles with the presynaptic plasma membrane. This gene encodes a syntaxin 1 binding protein. In rat, a similar protein dissociates syntaxin 1 from the Munc18/n-Sec1/rbSec1 complex to form a 10S complex, an intermediate which can be converted to the 7S SNARE complex. Thus this protein is thought to be involved in neurotransmitter release by stimulating SNARE complex formation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some background sensitive prenatal lethality and increased synaptic transmission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931440F15Rik	A	G	11: 29,824,039	S473P	probably benign	Het
Abca8a	A	G	11: 110,091,515		probably benign	Het
Adgre5	A	G	8: 83,729,109	V190A	probably damaging	Het
Akap6	A	G	12: 53,104,612	N1153S	probably benign	Het
Aldh1a7	G	A	19: 20,727,455	H20Y	probably benign	Het
B430306N03Rik	A	G	17: 48,324,148	E278G	probably benign	Het
Cacna1b	C	A	2: 24,616,879	R72L	probably null	Het
Cc2d2a	C	G	5: 43,706,222	S675R	probably damaging	Het
Ccdc88b	T	A	19: 6,849,226	E1040D	probably damaging	Het
Cmtm7	A	G	9: 114,763,364	V55A	probably damaging	Het
Coq4	A	C	2: 29,789,926	T77P	probably damaging	Het
Cyp2j11	C	A	4: 96,339,974	W136L	probably damaging	Het
Dctn2	T	A	10: 127,275,049	Y86*	probably null	Het
Ddx56	A	G	11: 6,263,937		probably null	Het
Dopey2	T	C	16: 93,716,262	S30P	probably damaging	Het
Ep400	T	C	5: 110,703,575	K1347R	unknown	Het
Fat3	T	A	9: 15,997,057	T2550S	possibly damaging	Het
Fcrla	G	T	1: 170,927,526	C5*	probably null	Het
Fermt1	T	A	2: 132,922,842	D365V	probably damaging	Het
Fhod3	A	G	18: 24,989,965		probably benign	Het
Fhod3	A	G	18: 25,085,601	D807G	probably benign	Het
Fnip1	C	T	11: 54,480,684	T177I	probably damaging	Het
Gart	T	C	16: 91,628,149	Y662C	probably damaging	Het
Gda	A	T	19: 21,397,640		probably benign	Het
Gk	A	G	X: 85,760,580	I85T	probably damaging	Het
Gm12169	A	G	11: 46,528,531	D58G	possibly damaging	Het
Gm14548	C	T	7: 3,897,638	V38M	probably damaging	Het
Gm3476	A	G	14: 6,118,358	L255P	possibly damaging	Het
Gm9966	T	C	7: 95,958,477	C2R	unknown	Het
Gnpda1	T	C	18: 38,333,190		probably null	Het
Gtf2h4	G	A	17: 35,670,198	L246F	possibly damaging	Het
Hao1	A	T	2: 134,523,060	S216T	probably benign	Het
Hnrnpr	C	A	4: 136,332,488	S301*	probably null	Het
Hsd3b2	A	G	3: 98,712,026	I201T	probably benign	Het
Jade2	T	C	11: 51,818,538	E548G	possibly damaging	Het
Katnbl1	T	C	2: 112,409,179	I241T	probably benign	Het
Keap1	G	T	9: 21,233,806	Q299K	probably benign	Het
Kif1a	T	C	1: 93,019,031	I1650V	possibly damaging	Het
Lrba	G	A	3: 86,664,501	G275R	probably damaging	Het
Map3k9	C	A	12: 81,780,790	E29*	probably null	Het
Mat1a	G	A	14: 41,121,437	V307I	probably damaging	Het
Mcm2	A	T	6: 88,891,803	M324K	possibly damaging	Het
Metap1d	T	C	2: 71,511,527	V155A	probably damaging	Het
Mtbp	A	G	15: 55,564,677		probably benign	Het
Myh14	T	C	7: 44,657,925	T231A	probably benign	Het
Mylk4	A	T	13: 32,724,853	D90E	probably benign	Het
Myo15b	T	A	11: 115,882,254	I1837K	possibly damaging	Het
Myo3a	T	A	2: 22,291,922	H242Q	probably damaging	Het
Nxn	A	G	11: 76,261,672		probably benign	Het
Olfr791	T	A	10: 129,527,049	V274D	probably damaging	Het
Pak3	C	A	X: 143,791,302	A553E	possibly damaging	Het
Pdia2	T	A	17: 26,198,105	T122S	possibly damaging	Het
Plod2	A	G	9: 92,581,257	T132A	probably benign	Het
Ptprz1	T	A	6: 23,035,040		probably benign	Het
Rad54b	A	C	4: 11,601,693	N416T	probably damaging	Het
Recql4	A	T	15: 76,703,837	Y1142*	probably null	Het
Rnf216	A	G	5: 142,992,806	V859A	probably benign	Het
Scnm1	G	T	3: 95,130,273	P161T	possibly damaging	Het
Serpinb6b	A	G	13: 32,978,240	I222V	probably benign	Het
Serpinf1	A	G	11: 75,411,007	I274T	possibly damaging	Het
Slc28a1	T	C	7: 81,169,586	F641L	probably benign	Het
Slc8a2	A	G	7: 16,152,920	I657V	probably benign	Het
Smchd1	A	G	17: 71,407,237	I877T	possibly damaging	Het
Spata31	T	C	13: 64,920,865	Y276H	possibly damaging	Het
Spire2	A	G	8: 123,363,071	D447G	probably benign	Het
Stk3	G	A	15: 35,073,217	T119I	probably damaging	Het
Sult2a5	T	C	7: 13,670,684	F282S	probably damaging	Het
Syk	A	T	13: 52,622,708	D248V	probably damaging	Het
Thoc6	C	T	17: 23,669,390		probably benign	Het
Tll2	T	A	19: 41,128,497	D293V	possibly damaging	Het
Umodl1	G	A	17: 30,984,043	V457M	probably damaging	Het
Usp19	T	A	9: 108,499,325	C689*	probably null	Het
Usp24	T	G	4: 106,410,286	V1955G	probably damaging	Het
Vmn1r226	T	C	17: 20,687,580	S25P	probably damaging	Het
Vmn2r69	C	T	7: 85,411,683	C231Y	probably damaging	Het
Wdr73	C	T	7: 80,893,333	D176N	probably benign	Het
Wnt7b	T	A	15: 85,559,080	I41F	probably damaging	Het
Zfhx3	T	C	8: 108,956,248	S3440P	unknown	Het
Zfp52	T	G	17: 21,560,164	N91K	probably benign	Het
Zfp930	C	A	8: 69,228,705	Q350K	probably benign	Het
Zfp949	T	C	9: 88,570,062	S562P	probably damaging	Het

Other mutations in Stxbp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00466:Stxbp5	APN	10	9799950	missense	probably damaging	1.00
IGL00950:Stxbp5	APN	10	9808602	splice site	probably benign
IGL01725:Stxbp5	APN	10	9817411	missense	probably damaging	1.00
IGL02150:Stxbp5	APN	10	9762821	missense	probably damaging	1.00
IGL02339:Stxbp5	APN	10	9816297	missense	possibly damaging	0.89
IGL02697:Stxbp5	APN	10	9762956	nonsense	probably null
IGL02720:Stxbp5	APN	10	9789361	critical splice donor site	probably null
IGL03155:Stxbp5	APN	10	9816290	missense	probably null	1.00
IGL03288:Stxbp5	APN	10	9866703	splice site	probably null
Fatty_fish	UTSW	10	9770551	missense	probably damaging	1.00
reindeer	UTSW	10	9838092	missense	probably damaging	1.00
H8562:Stxbp5	UTSW	10	9769443	missense	probably benign	0.36
PIT4544001:Stxbp5	UTSW	10	9817304	critical splice donor site	probably null
R0025:Stxbp5	UTSW	10	9762748	missense	probably damaging	1.00
R0025:Stxbp5	UTSW	10	9762748	missense	probably damaging	1.00
R0219:Stxbp5	UTSW	10	9770528	missense	probably benign	0.36
R0226:Stxbp5	UTSW	10	9866698	splice site	probably benign
R0631:Stxbp5	UTSW	10	9784358	missense	probably benign
R0723:Stxbp5	UTSW	10	9768873	missense	probably damaging	1.00
R0833:Stxbp5	UTSW	10	9865099	missense	probably damaging	1.00
R0836:Stxbp5	UTSW	10	9865099	missense	probably damaging	1.00
R0863:Stxbp5	UTSW	10	9809040	missense	possibly damaging	0.86
R1225:Stxbp5	UTSW	10	9812391	missense	possibly damaging	0.94
R1271:Stxbp5	UTSW	10	9816269	missense	probably damaging	1.00
R1536:Stxbp5	UTSW	10	9838092	missense	probably damaging	1.00
R1852:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1884:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1902:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1918:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R2174:Stxbp5	UTSW	10	9835846	missense	possibly damaging	0.69
R3773:Stxbp5	UTSW	10	9768927	missense	probably damaging	1.00
R3901:Stxbp5	UTSW	10	9769419	missense	probably damaging	1.00
R3981:Stxbp5	UTSW	10	9789316	intron	probably benign
R4572:Stxbp5	UTSW	10	9838144	missense	probably damaging	0.99
R4764:Stxbp5	UTSW	10	9770623	missense	probably damaging	1.00
R4841:Stxbp5	UTSW	10	9762891	missense	probably benign	0.06
R4842:Stxbp5	UTSW	10	9762891	missense	probably benign	0.06
R4884:Stxbp5	UTSW	10	9812341	nonsense	probably null
R4887:Stxbp5	UTSW	10	9809100	missense	probably benign
R4930:Stxbp5	UTSW	10	9760866	utr 3 prime	probably benign
R5065:Stxbp5	UTSW	10	9770551	missense	probably damaging	1.00
R5285:Stxbp5	UTSW	10	9798275	critical splice acceptor site	probably null
R5306:Stxbp5	UTSW	10	9799991	missense	probably damaging	1.00
R5455:Stxbp5	UTSW	10	9808508	missense	probably benign
R5531:Stxbp5	UTSW	10	9762924	nonsense	probably null
R5605:Stxbp5	UTSW	10	9769746	intron	probably benign
R5614:Stxbp5	UTSW	10	9760894	utr 3 prime	probably benign
R5805:Stxbp5	UTSW	10	9900586	missense	probably benign
R5990:Stxbp5	UTSW	10	9835933	missense	probably damaging	1.00
R6025:Stxbp5	UTSW	10	9800028	missense	probably benign	0.00
R6056:Stxbp5	UTSW	10	9770686	missense	probably benign	0.00
R6147:Stxbp5	UTSW	10	9808472	missense	possibly damaging	0.93
R6194:Stxbp5	UTSW	10	9817339	missense	probably damaging	0.99
R6284:Stxbp5	UTSW	10	9767179	missense	probably benign	0.32
R6284:Stxbp5	UTSW	10	9767187	missense	probably damaging	1.00
R6394:Stxbp5	UTSW	10	9899231	nonsense	probably null
R6427:Stxbp5	UTSW	10	9899254	missense	probably damaging	1.00
R6894:Stxbp5	UTSW	10	9784361	missense	probably benign	0.00
R7229:Stxbp5	UTSW	10	9798187	missense	probably damaging	1.00
R7337:Stxbp5	UTSW	10	9809130	missense	possibly damaging	0.93
R7686:Stxbp5	UTSW	10	9769410	missense	probably damaging	0.99
R7811:Stxbp5	UTSW	10	9808504	missense	probably benign
R7974:Stxbp5	UTSW	10	9770695	splice site	probably null
R8009:Stxbp5	UTSW	10	9816302	missense	probably damaging	1.00
R8287:Stxbp5	UTSW	10	9784385	missense	probably benign
R8353:Stxbp5	UTSW	10	9809048	missense	probably benign	0.30
R8360:Stxbp5	UTSW	10	9812259	critical splice donor site	probably null
R8453:Stxbp5	UTSW	10	9809048	missense	probably benign	0.30
R8487:Stxbp5	UTSW	10	9812289	missense	possibly damaging	0.80
R8548:Stxbp5	UTSW	10	9817306	missense	probably null	0.98
R8805:Stxbp5	UTSW	10	9838115	nonsense	probably null
X0020:Stxbp5	UTSW	10	9762890	missense	possibly damaging	0.47
Z1176:Stxbp5	UTSW	10	9900545	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- GCCCCAATTACCACCATTGATG -3'
(R):5'- AAACGCTTCACTGTTTTCACAC -3'

Sequencing Primer
(F):5'- GGTCTATTAGGAAGTTATGAACACAG -3'
(R):5'- ACGCTTCACTGTTTTCACACATTTAC -3'

Posted On

2014-07-14