Mutagenetix > Incidental Mutations

Incidental Mutation 'R1917:Fnip1'

212626

Institutional Source

Beutler Lab

Gene Symbol

Fnip1

Ensembl Gene

ENSMUSG00000035992

Gene Name

folliculin interacting protein 1

Synonyms

A730024A03Rik

MMRRC Submission

039935-MU

Accession Numbers

Ncbi RefSeq: NM_173753.4; MGI:2444668

Is this an essential gene?

Possibly essential (E-score: 0.702) question?

Stock #

R1917 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

54438199-54518235 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 54480684 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 177 (T177I)

Ref Sequence

ENSEMBL: ENSMUSP00000049026 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046835] [ENSMUST00000143650]

Predicted Effect

probably damaging
Transcript: ENSMUST00000046835
AA Change: T177I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000049026
Gene: ENSMUSG00000035992
AA Change: T177I

Domain	Start	End	E-Value	Type
Pfam:FNIP_N	41	159	1.7e-29	PFAM
Pfam:FNIP_M	316	549	9.9e-92	PFAM
Pfam:FNIP_C	975	1161	7.6e-73	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000143650
AA Change: T153I

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000121399
Gene: ENSMUSG00000035992
AA Change: T153I

Domain	Start	End	E-Value	Type
Pfam:FNIP_N	17	139	3.9e-36	PFAM
Pfam:FNIP_M	288	526	5.1e-87	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.8%
20x: 93.6%

Validation Efficiency

100% (83/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the folliculin-interacting protein family. The encoded protein binds to the tumor suppressor folliculin and to AMP-activated protein kinase (AMPK) and be involved in cellular metabolism and nutrient sensing by regulating the AMPK-mechanistic target of rapamycin signaling pathway. A homologous binding partner of this protein, folliculin-interacting protein 2, has similar binding activities and may suggest functional redundancy within this protein family. Both folliculin-interacting proteins have also been shown to bind the molecular chaperone heat shock protein-90 (Hsp90) and they may function as a co-chaperones in the stabilization of tumor suppressor folliculin which is a target of Hsp90 chaperone activity. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for an ENU-induced or targeted allele exhibit arrested B cell development at the pre-B cell stage with increased B cell apoptosis. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(1) Gene trapped(2)

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931440F15Rik	A	G	11: 29,824,039	S473P	probably benign	Het
Abca8a	A	G	11: 110,091,515		probably benign	Het
Adgre5	A	G	8: 83,729,109	V190A	probably damaging	Het
Akap6	A	G	12: 53,104,612	N1153S	probably benign	Het
Aldh1a7	G	A	19: 20,727,455	H20Y	probably benign	Het
B430306N03Rik	A	G	17: 48,324,148	E278G	probably benign	Het
Cacna1b	C	A	2: 24,616,879	R72L	probably null	Het
Cc2d2a	C	G	5: 43,706,222	S675R	probably damaging	Het
Ccdc88b	T	A	19: 6,849,226	E1040D	probably damaging	Het
Cmtm7	A	G	9: 114,763,364	V55A	probably damaging	Het
Coq4	A	C	2: 29,789,926	T77P	probably damaging	Het
Cyp2j11	C	A	4: 96,339,974	W136L	probably damaging	Het
Dctn2	T	A	10: 127,275,049	Y86*	probably null	Het
Ddx56	A	G	11: 6,263,937		probably null	Het
Dopey2	T	C	16: 93,716,262	S30P	probably damaging	Het
Ep400	T	C	5: 110,703,575	K1347R	unknown	Het
Fat3	T	A	9: 15,997,057	T2550S	possibly damaging	Het
Fcrla	G	T	1: 170,927,526	C5*	probably null	Het
Fermt1	T	A	2: 132,922,842	D365V	probably damaging	Het
Fhod3	A	G	18: 24,989,965		probably benign	Het
Fhod3	A	G	18: 25,085,601	D807G	probably benign	Het
Gart	T	C	16: 91,628,149	Y662C	probably damaging	Het
Gda	A	T	19: 21,397,640		probably benign	Het
Gk	A	G	X: 85,760,580	I85T	probably damaging	Het
Gm12169	A	G	11: 46,528,531	D58G	possibly damaging	Het
Gm14548	C	T	7: 3,897,638	V38M	probably damaging	Het
Gm3476	A	G	14: 6,118,358	L255P	possibly damaging	Het
Gm9966	T	C	7: 95,958,477	C2R	unknown	Het
Gnpda1	T	C	18: 38,333,190		probably null	Het
Gtf2h4	G	A	17: 35,670,198	L246F	possibly damaging	Het
Hao1	A	T	2: 134,523,060	S216T	probably benign	Het
Hnrnpr	C	A	4: 136,332,488	S301*	probably null	Het
Hsd3b2	A	G	3: 98,712,026	I201T	probably benign	Het
Jade2	T	C	11: 51,818,538	E548G	possibly damaging	Het
Katnbl1	T	C	2: 112,409,179	I241T	probably benign	Het
Keap1	G	T	9: 21,233,806	Q299K	probably benign	Het
Kif1a	T	C	1: 93,019,031	I1650V	possibly damaging	Het
Lrba	G	A	3: 86,664,501	G275R	probably damaging	Het
Map3k9	C	A	12: 81,780,790	E29*	probably null	Het
Mat1a	G	A	14: 41,121,437	V307I	probably damaging	Het
Mcm2	A	T	6: 88,891,803	M324K	possibly damaging	Het
Metap1d	T	C	2: 71,511,527	V155A	probably damaging	Het
Mtbp	A	G	15: 55,564,677		probably benign	Het
Myh14	T	C	7: 44,657,925	T231A	probably benign	Het
Mylk4	A	T	13: 32,724,853	D90E	probably benign	Het
Myo15b	T	A	11: 115,882,254	I1837K	possibly damaging	Het
Myo3a	T	A	2: 22,291,922	H242Q	probably damaging	Het
Nxn	A	G	11: 76,261,672		probably benign	Het
Olfr791	T	A	10: 129,527,049	V274D	probably damaging	Het
Pak3	C	A	X: 143,791,302	A553E	possibly damaging	Het
Pdia2	T	A	17: 26,198,105	T122S	possibly damaging	Het
Plod2	A	G	9: 92,581,257	T132A	probably benign	Het
Ptprz1	T	A	6: 23,035,040		probably benign	Het
Rad54b	A	C	4: 11,601,693	N416T	probably damaging	Het
Recql4	A	T	15: 76,703,837	Y1142*	probably null	Het
Rnf216	A	G	5: 142,992,806	V859A	probably benign	Het
Scnm1	G	T	3: 95,130,273	P161T	possibly damaging	Het
Serpinb6b	A	G	13: 32,978,240	I222V	probably benign	Het
Serpinf1	A	G	11: 75,411,007	I274T	possibly damaging	Het
Slc28a1	T	C	7: 81,169,586	F641L	probably benign	Het
Slc8a2	A	G	7: 16,152,920	I657V	probably benign	Het
Smchd1	A	G	17: 71,407,237	I877T	possibly damaging	Het
Spata31	T	C	13: 64,920,865	Y276H	possibly damaging	Het
Spire2	A	G	8: 123,363,071	D447G	probably benign	Het
Stk3	G	A	15: 35,073,217	T119I	probably damaging	Het
Stxbp5	C	A	10: 9,812,298	V420F	possibly damaging	Het
Sult2a5	T	C	7: 13,670,684	F282S	probably damaging	Het
Syk	A	T	13: 52,622,708	D248V	probably damaging	Het
Thoc6	C	T	17: 23,669,390		probably benign	Het
Tll2	T	A	19: 41,128,497	D293V	possibly damaging	Het
Umodl1	G	A	17: 30,984,043	V457M	probably damaging	Het
Usp19	T	A	9: 108,499,325	C689*	probably null	Het
Usp24	T	G	4: 106,410,286	V1955G	probably damaging	Het
Vmn1r226	T	C	17: 20,687,580	S25P	probably damaging	Het
Vmn2r69	C	T	7: 85,411,683	C231Y	probably damaging	Het
Wdr73	C	T	7: 80,893,333	D176N	probably benign	Het
Wnt7b	T	A	15: 85,559,080	I41F	probably damaging	Het
Zfhx3	T	C	8: 108,956,248	S3440P	unknown	Het
Zfp52	T	G	17: 21,560,164	N91K	probably benign	Het
Zfp930	C	A	8: 69,228,705	Q350K	probably benign	Het
Zfp949	T	C	9: 88,570,062	S562P	probably damaging	Het

Other mutations in Fnip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01449:Fnip1	APN	11	54499508	missense	probably damaging	1.00
IGL01590:Fnip1	APN	11	54493300	missense	probably damaging	1.00
IGL01959:Fnip1	APN	11	54490912	missense	possibly damaging	0.95
IGL02157:Fnip1	APN	11	54487763	missense	probably damaging	1.00
IGL02197:Fnip1	APN	11	54493374	missense	probably damaging	1.00
IGL02476:Fnip1	APN	11	54499567	splice site	probably benign
IGL02639:Fnip1	APN	11	54475640	nonsense	probably null
IGL02742:Fnip1	APN	11	54493351	missense	probably damaging	1.00
hamel	UTSW	11	54480685	critical splice donor site	probably benign
hamel2	UTSW	11	54502271	missense	probably damaging	1.00
Normandy	UTSW	11	54493181	splice site	probably benign
H8562:Fnip1	UTSW	11	54480297	missense	probably damaging	0.98
P0043:Fnip1	UTSW	11	54503225	missense	probably benign	0.00
R0114:Fnip1	UTSW	11	54487801	splice site	probably benign
R0278:Fnip1	UTSW	11	54489343	splice site	probably null
R0409:Fnip1	UTSW	11	54480354	splice site	probably null
R0840:Fnip1	UTSW	11	54493181	splice site	probably benign
R1131:Fnip1	UTSW	11	54493303	missense	possibly damaging	0.82
R1205:Fnip1	UTSW	11	54502306	missense	possibly damaging	0.91
R1271:Fnip1	UTSW	11	54503297	missense	probably benign
R1817:Fnip1	UTSW	11	54502453	missense	probably benign	0.30
R1826:Fnip1	UTSW	11	54466164	missense	probably damaging	1.00
R1872:Fnip1	UTSW	11	54487735	missense	probably damaging	1.00
R1883:Fnip1	UTSW	11	54515547	missense	probably damaging	1.00
R1918:Fnip1	UTSW	11	54480684	missense	probably damaging	0.99
R1919:Fnip1	UTSW	11	54480684	missense	probably damaging	0.99
R2010:Fnip1	UTSW	11	54482503	missense	probably damaging	1.00
R2117:Fnip1	UTSW	11	54500624	missense	probably damaging	1.00
R2329:Fnip1	UTSW	11	54466107	missense	probably damaging	0.98
R2337:Fnip1	UTSW	11	54475737	missense	probably damaging	0.98
R2850:Fnip1	UTSW	11	54502677	missense	probably benign	0.32
R2863:Fnip1	UTSW	11	54502424	missense	probably damaging	1.00
R2864:Fnip1	UTSW	11	54502424	missense	probably damaging	1.00
R2865:Fnip1	UTSW	11	54502424	missense	probably damaging	1.00
R3936:Fnip1	UTSW	11	54480239	splice site	probably null
R4017:Fnip1	UTSW	11	54509987	missense	probably benign	0.14
R4033:Fnip1	UTSW	11	54502471	missense	probably benign	0.02
R4668:Fnip1	UTSW	11	54503559	missense	probably damaging	1.00
R4695:Fnip1	UTSW	11	54499419	missense	probably damaging	1.00
R4762:Fnip1	UTSW	11	54466171	missense	probably damaging	1.00
R4762:Fnip1	UTSW	11	54499526	missense	probably benign	0.01
R4777:Fnip1	UTSW	11	54500556	missense	probably damaging	1.00
R4863:Fnip1	UTSW	11	54515556	missense	possibly damaging	0.52
R5369:Fnip1	UTSW	11	54502589	missense	probably benign
R5481:Fnip1	UTSW	11	54502644	missense	probably benign	0.01
R5562:Fnip1	UTSW	11	54489342	critical splice donor site	probably null
R5563:Fnip1	UTSW	11	54504862	missense	probably benign	0.05
R5628:Fnip1	UTSW	11	54503633	missense	probably benign	0.08
R5689:Fnip1	UTSW	11	54502289	missense	probably damaging	1.00
R6009:Fnip1	UTSW	11	54502271	missense	probably damaging	1.00
R6120:Fnip1	UTSW	11	54510000	missense	probably benign	0.23
R6429:Fnip1	UTSW	11	54515567	missense	probably damaging	1.00
R6546:Fnip1	UTSW	11	54502611	missense	probably benign	0.03
R6600:Fnip1	UTSW	11	54503099	missense	probably benign
R6882:Fnip1	UTSW	11	54509898	missense	probably damaging	1.00
R6966:Fnip1	UTSW	11	54482559	missense	probably benign	0.00
R7009:Fnip1	UTSW	11	54502935	missense	probably damaging	1.00
R7664:Fnip1	UTSW	11	54466125	missense	probably damaging	1.00
R7706:Fnip1	UTSW	11	54515499	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- GATGTTGTCATGAAATCTCTGCAAC -3'
(R):5'- CTAGGATGGAGATGTGCTCAAC -3'

Sequencing Primer
(F):5'- CTGTGTTCTTTCATAGCTCG -3'
(R):5'- GCTCAACATTTTGCTTCTAACAAACC -3'

Posted On

2014-07-14