Incidental Mutation 'R1917:Gart'
ID212646
Institutional Source Beutler Lab
Gene Symbol Gart
Ensembl Gene ENSMUSG00000022962
Gene Namephosphoribosylglycinamide formyltransferase
SynonymsGaps, Prgs
MMRRC Submission 039935-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1917 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location91621186-91646952 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91628149 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 662 (Y662C)
Ref Sequence ENSEMBL: ENSMUSP00000156002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023684] [ENSMUST00000156713] [ENSMUST00000232289]
Predicted Effect probably damaging
Transcript: ENSMUST00000023684
AA Change: Y662C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023684
Gene: ENSMUSG00000022962
AA Change: Y662C

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 6.4e-37 PFAM
GARS_A 105 298 4.42e-132 SMART
GARS_C 333 426 1.33e-44 SMART
Pfam:AIRS 473 593 1.2e-17 PFAM
Pfam:AIRS_C 606 777 9e-40 PFAM
Pfam:Formyl_trans_N 808 988 3.4e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138207
Predicted Effect probably benign
Transcript: ENSMUST00000156713
SMART Domains Protein: ENSMUSP00000119272
Gene: ENSMUSG00000022962

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 1.4e-40 PFAM
GARS_A 105 298 4.42e-132 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000232289
AA Change: Y662C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9681 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.8%
  • 20x: 93.6%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a trifunctional polypeptide. It has phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase activity which is required for de novo purine biosynthesis. This enzyme is highly conserved in vertebrates. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik A G 11: 29,824,039 S473P probably benign Het
Abca8a A G 11: 110,091,515 probably benign Het
Adgre5 A G 8: 83,729,109 V190A probably damaging Het
Akap6 A G 12: 53,104,612 N1153S probably benign Het
Aldh1a7 G A 19: 20,727,455 H20Y probably benign Het
B430306N03Rik A G 17: 48,324,148 E278G probably benign Het
Cacna1b C A 2: 24,616,879 R72L probably null Het
Cc2d2a C G 5: 43,706,222 S675R probably damaging Het
Ccdc88b T A 19: 6,849,226 E1040D probably damaging Het
Cmtm7 A G 9: 114,763,364 V55A probably damaging Het
Coq4 A C 2: 29,789,926 T77P probably damaging Het
Cyp2j11 C A 4: 96,339,974 W136L probably damaging Het
Dctn2 T A 10: 127,275,049 Y86* probably null Het
Ddx56 A G 11: 6,263,937 probably null Het
Dopey2 T C 16: 93,716,262 S30P probably damaging Het
Ep400 T C 5: 110,703,575 K1347R unknown Het
Fat3 T A 9: 15,997,057 T2550S possibly damaging Het
Fcrla G T 1: 170,927,526 C5* probably null Het
Fermt1 T A 2: 132,922,842 D365V probably damaging Het
Fhod3 A G 18: 24,989,965 probably benign Het
Fhod3 A G 18: 25,085,601 D807G probably benign Het
Fnip1 C T 11: 54,480,684 T177I probably damaging Het
Gda A T 19: 21,397,640 probably benign Het
Gk A G X: 85,760,580 I85T probably damaging Het
Gm12169 A G 11: 46,528,531 D58G possibly damaging Het
Gm14548 C T 7: 3,897,638 V38M probably damaging Het
Gm3476 A G 14: 6,118,358 L255P possibly damaging Het
Gm9966 T C 7: 95,958,477 C2R unknown Het
Gnpda1 T C 18: 38,333,190 probably null Het
Gtf2h4 G A 17: 35,670,198 L246F possibly damaging Het
Hao1 A T 2: 134,523,060 S216T probably benign Het
Hnrnpr C A 4: 136,332,488 S301* probably null Het
Hsd3b2 A G 3: 98,712,026 I201T probably benign Het
Jade2 T C 11: 51,818,538 E548G possibly damaging Het
Katnbl1 T C 2: 112,409,179 I241T probably benign Het
Keap1 G T 9: 21,233,806 Q299K probably benign Het
Kif1a T C 1: 93,019,031 I1650V possibly damaging Het
Lrba G A 3: 86,664,501 G275R probably damaging Het
Map3k9 C A 12: 81,780,790 E29* probably null Het
Mat1a G A 14: 41,121,437 V307I probably damaging Het
Mcm2 A T 6: 88,891,803 M324K possibly damaging Het
Metap1d T C 2: 71,511,527 V155A probably damaging Het
Mtbp A G 15: 55,564,677 probably benign Het
Myh14 T C 7: 44,657,925 T231A probably benign Het
Mylk4 A T 13: 32,724,853 D90E probably benign Het
Myo15b T A 11: 115,882,254 I1837K possibly damaging Het
Myo3a T A 2: 22,291,922 H242Q probably damaging Het
Nxn A G 11: 76,261,672 probably benign Het
Olfr791 T A 10: 129,527,049 V274D probably damaging Het
Pak3 C A X: 143,791,302 A553E possibly damaging Het
Pdia2 T A 17: 26,198,105 T122S possibly damaging Het
Plod2 A G 9: 92,581,257 T132A probably benign Het
Ptprz1 T A 6: 23,035,040 probably benign Het
Rad54b A C 4: 11,601,693 N416T probably damaging Het
Recql4 A T 15: 76,703,837 Y1142* probably null Het
Rnf216 A G 5: 142,992,806 V859A probably benign Het
Scnm1 G T 3: 95,130,273 P161T possibly damaging Het
Serpinb6b A G 13: 32,978,240 I222V probably benign Het
Serpinf1 A G 11: 75,411,007 I274T possibly damaging Het
Slc28a1 T C 7: 81,169,586 F641L probably benign Het
Slc8a2 A G 7: 16,152,920 I657V probably benign Het
Smchd1 A G 17: 71,407,237 I877T possibly damaging Het
Spata31 T C 13: 64,920,865 Y276H possibly damaging Het
Spire2 A G 8: 123,363,071 D447G probably benign Het
Stk3 G A 15: 35,073,217 T119I probably damaging Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Sult2a5 T C 7: 13,670,684 F282S probably damaging Het
Syk A T 13: 52,622,708 D248V probably damaging Het
Thoc6 C T 17: 23,669,390 probably benign Het
Tll2 T A 19: 41,128,497 D293V possibly damaging Het
Umodl1 G A 17: 30,984,043 V457M probably damaging Het
Usp19 T A 9: 108,499,325 C689* probably null Het
Usp24 T G 4: 106,410,286 V1955G probably damaging Het
Vmn1r226 T C 17: 20,687,580 S25P probably damaging Het
Vmn2r69 C T 7: 85,411,683 C231Y probably damaging Het
Wdr73 C T 7: 80,893,333 D176N probably benign Het
Wnt7b T A 15: 85,559,080 I41F probably damaging Het
Zfhx3 T C 8: 108,956,248 S3440P unknown Het
Zfp52 T G 17: 21,560,164 N91K probably benign Het
Zfp930 C A 8: 69,228,705 Q350K probably benign Het
Zfp949 T C 9: 88,570,062 S562P probably damaging Het
Other mutations in Gart
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Gart APN 16 91638789 missense possibly damaging 0.58
IGL00837:Gart APN 16 91638720 unclassified probably benign
IGL01010:Gart APN 16 91643092 nonsense probably null
IGL01064:Gart APN 16 91623007 missense probably damaging 1.00
IGL01451:Gart APN 16 91625512 missense probably benign
IGL02084:Gart APN 16 91621600 missense probably benign
IGL02301:Gart APN 16 91621837 splice site probably benign
IGL02814:Gart APN 16 91623457 missense possibly damaging 0.58
sylvester UTSW 16 91630602 splice site probably benign
PIT4453001:Gart UTSW 16 91636538 missense probably damaging 1.00
R0137:Gart UTSW 16 91625394 missense probably benign
R0197:Gart UTSW 16 91623403 missense possibly damaging 0.95
R0321:Gart UTSW 16 91623037 unclassified probably benign
R0322:Gart UTSW 16 91623037 unclassified probably benign
R0398:Gart UTSW 16 91639449 missense probably damaging 1.00
R0410:Gart UTSW 16 91641327 missense probably damaging 1.00
R0496:Gart UTSW 16 91623037 unclassified probably benign
R0620:Gart UTSW 16 91630602 splice site probably benign
R0628:Gart UTSW 16 91633902 missense probably benign 0.01
R0883:Gart UTSW 16 91623403 missense possibly damaging 0.95
R1346:Gart UTSW 16 91628182 splice site probably null
R1490:Gart UTSW 16 91624344 missense probably damaging 1.00
R1686:Gart UTSW 16 91625349 missense probably damaging 1.00
R1751:Gart UTSW 16 91642949 splice site probably benign
R2144:Gart UTSW 16 91630081 missense probably damaging 1.00
R2421:Gart UTSW 16 91643040 splice site probably null
R4305:Gart UTSW 16 91633992 missense possibly damaging 0.48
R4377:Gart UTSW 16 91634094 missense probably benign 0.31
R4599:Gart UTSW 16 91622945 nonsense probably null
R4619:Gart UTSW 16 91625433 missense probably damaging 1.00
R4620:Gart UTSW 16 91625433 missense probably damaging 1.00
R5112:Gart UTSW 16 91634045 missense probably benign 0.02
R5902:Gart UTSW 16 91628527 missense probably damaging 1.00
R5975:Gart UTSW 16 91624336 missense probably damaging 1.00
R6736:Gart UTSW 16 91636107 missense probably benign 0.21
R7041:Gart UTSW 16 91643143 start gained probably benign
R7150:Gart UTSW 16 91628463 missense possibly damaging 0.69
R7320:Gart UTSW 16 91621681 missense probably benign 0.00
R7709:Gart UTSW 16 91622965 missense possibly damaging 0.92
R7748:Gart UTSW 16 91630652 missense possibly damaging 0.66
R7911:Gart UTSW 16 91638784 missense probably benign 0.23
R8066:Gart UTSW 16 91639447 missense probably benign
R8209:Gart UTSW 16 91628153 missense possibly damaging 0.78
R8824:Gart UTSW 16 91630703 missense possibly damaging 0.64
R8840:Gart UTSW 16 91636122 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCCAAATCCACTGCAGACTG -3'
(R):5'- GAAACCCAGGTCACTAGGACTAG -3'

Sequencing Primer
(F):5'- ATCCACTGCAGACTGCTGAG -3'
(R):5'- CCAGGTCACTAGGACTAGGATGG -3'
Posted On2014-07-14