Incidental Mutation 'R1917:Dopey2'
ID212647
Institutional Source Beutler Lab
Gene Symbol Dopey2
Ensembl Gene ENSMUSG00000022946
Gene Namedopey family member 2
Synonyms0610038M01Rik, 2610510B01Rik
MMRRC Submission 039935-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1917 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location93711904-93810590 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93716262 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 30 (S30P)
Ref Sequence ENSEMBL: ENSMUSP00000044437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045004] [ENSMUST00000228846]
Predicted Effect probably damaging
Transcript: ENSMUST00000045004
AA Change: S30P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044437
Gene: ENSMUSG00000022946
AA Change: S30P

DomainStartEndE-ValueType
Pfam:Dopey_N 11 308 3.9e-104 PFAM
low complexity region 651 666 N/A INTRINSIC
low complexity region 709 719 N/A INTRINSIC
low complexity region 747 759 N/A INTRINSIC
low complexity region 1186 1199 N/A INTRINSIC
low complexity region 1436 1451 N/A INTRINSIC
low complexity region 1893 1908 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226418
Predicted Effect possibly damaging
Transcript: ENSMUST00000228846
AA Change: S30P

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.1760 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.8%
  • 20x: 93.6%
Validation Efficiency 100% (83/83)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik A G 11: 29,824,039 S473P probably benign Het
Abca8a A G 11: 110,091,515 probably benign Het
Adgre5 A G 8: 83,729,109 V190A probably damaging Het
Akap6 A G 12: 53,104,612 N1153S probably benign Het
Aldh1a7 G A 19: 20,727,455 H20Y probably benign Het
B430306N03Rik A G 17: 48,324,148 E278G probably benign Het
Cacna1b C A 2: 24,616,879 R72L probably null Het
Cc2d2a C G 5: 43,706,222 S675R probably damaging Het
Ccdc88b T A 19: 6,849,226 E1040D probably damaging Het
Cmtm7 A G 9: 114,763,364 V55A probably damaging Het
Coq4 A C 2: 29,789,926 T77P probably damaging Het
Cyp2j11 C A 4: 96,339,974 W136L probably damaging Het
Dctn2 T A 10: 127,275,049 Y86* probably null Het
Ddx56 A G 11: 6,263,937 probably null Het
Ep400 T C 5: 110,703,575 K1347R unknown Het
Fat3 T A 9: 15,997,057 T2550S possibly damaging Het
Fcrla G T 1: 170,927,526 C5* probably null Het
Fermt1 T A 2: 132,922,842 D365V probably damaging Het
Fhod3 A G 18: 24,989,965 probably benign Het
Fhod3 A G 18: 25,085,601 D807G probably benign Het
Fnip1 C T 11: 54,480,684 T177I probably damaging Het
Gart T C 16: 91,628,149 Y662C probably damaging Het
Gda A T 19: 21,397,640 probably benign Het
Gk A G X: 85,760,580 I85T probably damaging Het
Gm12169 A G 11: 46,528,531 D58G possibly damaging Het
Gm14548 C T 7: 3,897,638 V38M probably damaging Het
Gm3476 A G 14: 6,118,358 L255P possibly damaging Het
Gm9966 T C 7: 95,958,477 C2R unknown Het
Gnpda1 T C 18: 38,333,190 probably null Het
Gtf2h4 G A 17: 35,670,198 L246F possibly damaging Het
Hao1 A T 2: 134,523,060 S216T probably benign Het
Hnrnpr C A 4: 136,332,488 S301* probably null Het
Hsd3b2 A G 3: 98,712,026 I201T probably benign Het
Jade2 T C 11: 51,818,538 E548G possibly damaging Het
Katnbl1 T C 2: 112,409,179 I241T probably benign Het
Keap1 G T 9: 21,233,806 Q299K probably benign Het
Kif1a T C 1: 93,019,031 I1650V possibly damaging Het
Lrba G A 3: 86,664,501 G275R probably damaging Het
Map3k9 C A 12: 81,780,790 E29* probably null Het
Mat1a G A 14: 41,121,437 V307I probably damaging Het
Mcm2 A T 6: 88,891,803 M324K possibly damaging Het
Metap1d T C 2: 71,511,527 V155A probably damaging Het
Mtbp A G 15: 55,564,677 probably benign Het
Myh14 T C 7: 44,657,925 T231A probably benign Het
Mylk4 A T 13: 32,724,853 D90E probably benign Het
Myo15b T A 11: 115,882,254 I1837K possibly damaging Het
Myo3a T A 2: 22,291,922 H242Q probably damaging Het
Nxn A G 11: 76,261,672 probably benign Het
Olfr791 T A 10: 129,527,049 V274D probably damaging Het
Pak3 C A X: 143,791,302 A553E possibly damaging Het
Pdia2 T A 17: 26,198,105 T122S possibly damaging Het
Plod2 A G 9: 92,581,257 T132A probably benign Het
Ptprz1 T A 6: 23,035,040 probably benign Het
Rad54b A C 4: 11,601,693 N416T probably damaging Het
Recql4 A T 15: 76,703,837 Y1142* probably null Het
Rnf216 A G 5: 142,992,806 V859A probably benign Het
Scnm1 G T 3: 95,130,273 P161T possibly damaging Het
Serpinb6b A G 13: 32,978,240 I222V probably benign Het
Serpinf1 A G 11: 75,411,007 I274T possibly damaging Het
Slc28a1 T C 7: 81,169,586 F641L probably benign Het
Slc8a2 A G 7: 16,152,920 I657V probably benign Het
Smchd1 A G 17: 71,407,237 I877T possibly damaging Het
Spata31 T C 13: 64,920,865 Y276H possibly damaging Het
Spire2 A G 8: 123,363,071 D447G probably benign Het
Stk3 G A 15: 35,073,217 T119I probably damaging Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Sult2a5 T C 7: 13,670,684 F282S probably damaging Het
Syk A T 13: 52,622,708 D248V probably damaging Het
Thoc6 C T 17: 23,669,390 probably benign Het
Tll2 T A 19: 41,128,497 D293V possibly damaging Het
Umodl1 G A 17: 30,984,043 V457M probably damaging Het
Usp19 T A 9: 108,499,325 C689* probably null Het
Usp24 T G 4: 106,410,286 V1955G probably damaging Het
Vmn1r226 T C 17: 20,687,580 S25P probably damaging Het
Vmn2r69 C T 7: 85,411,683 C231Y probably damaging Het
Wdr73 C T 7: 80,893,333 D176N probably benign Het
Wnt7b T A 15: 85,559,080 I41F probably damaging Het
Zfhx3 T C 8: 108,956,248 S3440P unknown Het
Zfp52 T G 17: 21,560,164 N91K probably benign Het
Zfp930 C A 8: 69,228,705 Q350K probably benign Het
Zfp949 T C 9: 88,570,062 S562P probably damaging Het
Other mutations in Dopey2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Dopey2 APN 16 93800026 unclassified probably benign
IGL00492:Dopey2 APN 16 93780782 missense probably benign 0.00
IGL00753:Dopey2 APN 16 93769624 missense probably benign
IGL00832:Dopey2 APN 16 93763401 missense probably benign 0.01
IGL00939:Dopey2 APN 16 93774083 missense possibly damaging 0.83
IGL01019:Dopey2 APN 16 93810229 missense probably benign 0.32
IGL01288:Dopey2 APN 16 93739293 missense possibly damaging 0.78
IGL01505:Dopey2 APN 16 93757116 missense possibly damaging 0.87
IGL01535:Dopey2 APN 16 93769958 nonsense probably null
IGL01696:Dopey2 APN 16 93770240 missense probably benign 0.00
IGL02077:Dopey2 APN 16 93780760 missense probably damaging 0.96
IGL02163:Dopey2 APN 16 93762427 missense possibly damaging 0.48
IGL02234:Dopey2 APN 16 93752151 missense probably benign
IGL02302:Dopey2 APN 16 93810117 missense probably benign 0.08
IGL02485:Dopey2 APN 16 93770822 missense probably damaging 1.00
IGL02563:Dopey2 APN 16 93777405 missense probably damaging 0.99
IGL02733:Dopey2 APN 16 93739191 missense possibly damaging 0.80
IGL02792:Dopey2 APN 16 93801572 missense possibly damaging 0.75
IGL02941:Dopey2 APN 16 93755473 missense probably benign 0.09
IGL03143:Dopey2 APN 16 93759655 missense probably benign
PIT4519001:Dopey2 UTSW 16 93762054 missense probably benign
R0320:Dopey2 UTSW 16 93810147 missense probably benign 0.02
R0499:Dopey2 UTSW 16 93770437 missense probably benign 0.00
R0501:Dopey2 UTSW 16 93752862 missense probably benign 0.00
R0534:Dopey2 UTSW 16 93762505 missense probably benign 0.04
R0583:Dopey2 UTSW 16 93755486 missense probably benign 0.30
R0626:Dopey2 UTSW 16 93763956 missense probably damaging 1.00
R0724:Dopey2 UTSW 16 93762325 missense probably benign 0.01
R0907:Dopey2 UTSW 16 93801593 missense probably damaging 1.00
R1263:Dopey2 UTSW 16 93777386 missense probably benign
R1378:Dopey2 UTSW 16 93770392 missense probably benign
R1572:Dopey2 UTSW 16 93770153 missense probably damaging 1.00
R1604:Dopey2 UTSW 16 93762570 missense probably benign
R1642:Dopey2 UTSW 16 93762315 missense probably benign 0.00
R1668:Dopey2 UTSW 16 93765516 missense probably damaging 1.00
R1669:Dopey2 UTSW 16 93769660 missense probably damaging 1.00
R1702:Dopey2 UTSW 16 93747621 missense possibly damaging 0.47
R1711:Dopey2 UTSW 16 93799926 missense probably damaging 1.00
R1968:Dopey2 UTSW 16 93782419 missense probably damaging 1.00
R1988:Dopey2 UTSW 16 93766173 missense probably damaging 1.00
R2029:Dopey2 UTSW 16 93769435 missense probably benign 0.36
R2139:Dopey2 UTSW 16 93771007 missense possibly damaging 0.78
R2355:Dopey2 UTSW 16 93770677 missense probably damaging 1.00
R3609:Dopey2 UTSW 16 93739332 missense probably damaging 1.00
R3792:Dopey2 UTSW 16 93771846 missense possibly damaging 0.54
R4364:Dopey2 UTSW 16 93770924 missense probably benign 0.00
R4380:Dopey2 UTSW 16 93716232 missense possibly damaging 0.53
R4455:Dopey2 UTSW 16 93766215 missense probably damaging 1.00
R4779:Dopey2 UTSW 16 93757081 missense probably damaging 1.00
R4820:Dopey2 UTSW 16 93793090 missense probably benign 0.00
R4834:Dopey2 UTSW 16 93740004 start codon destroyed probably null 0.70
R4866:Dopey2 UTSW 16 93763430 critical splice donor site probably null
R4882:Dopey2 UTSW 16 93752914 missense possibly damaging 0.95
R4900:Dopey2 UTSW 16 93763430 critical splice donor site probably null
R5153:Dopey2 UTSW 16 93774003 missense probably damaging 0.98
R5176:Dopey2 UTSW 16 93740043 missense probably damaging 1.00
R5206:Dopey2 UTSW 16 93801584 missense probably damaging 1.00
R5320:Dopey2 UTSW 16 93739986 missense probably damaging 1.00
R5361:Dopey2 UTSW 16 93770504 missense probably damaging 1.00
R5380:Dopey2 UTSW 16 93763410 missense probably damaging 0.96
R5476:Dopey2 UTSW 16 93773913 splice site probably null
R5502:Dopey2 UTSW 16 93793226 missense probably benign 0.00
R5543:Dopey2 UTSW 16 93798920 missense probably damaging 0.98
R5557:Dopey2 UTSW 16 93763931 missense probably damaging 0.96
R5901:Dopey2 UTSW 16 93769751 missense possibly damaging 0.88
R5907:Dopey2 UTSW 16 93801581 missense probably damaging 1.00
R6174:Dopey2 UTSW 16 93766222 missense probably damaging 1.00
R6256:Dopey2 UTSW 16 93807214 missense possibly damaging 0.94
R6383:Dopey2 UTSW 16 93782248 missense possibly damaging 0.76
R6525:Dopey2 UTSW 16 93809416 missense probably damaging 1.00
R6554:Dopey2 UTSW 16 93760458 missense probably benign 0.22
R6823:Dopey2 UTSW 16 93755485 missense possibly damaging 0.75
R7036:Dopey2 UTSW 16 93777490 missense probably benign 0.01
R7058:Dopey2 UTSW 16 93776990 missense probably benign 0.00
R7061:Dopey2 UTSW 16 93762063 missense probably benign 0.00
R7209:Dopey2 UTSW 16 93769845 missense probably benign
R7214:Dopey2 UTSW 16 93810135 missense possibly damaging 0.69
R7232:Dopey2 UTSW 16 93760485 critical splice donor site probably null
R7255:Dopey2 UTSW 16 93770146 missense probably damaging 1.00
R7335:Dopey2 UTSW 16 93747508 missense probably benign 0.04
R7535:Dopey2 UTSW 16 93806361 missense probably damaging 1.00
R7700:Dopey2 UTSW 16 93798761 intron probably null
R7763:Dopey2 UTSW 16 93755514 missense probably benign 0.00
R7814:Dopey2 UTSW 16 93799971 missense probably damaging 1.00
R7839:Dopey2 UTSW 16 93763941 missense probably damaging 1.00
R7862:Dopey2 UTSW 16 93749963 missense probably damaging 1.00
R7894:Dopey2 UTSW 16 93810204 missense probably benign 0.01
R7922:Dopey2 UTSW 16 93763941 missense probably damaging 1.00
R7945:Dopey2 UTSW 16 93749963 missense probably damaging 1.00
R7977:Dopey2 UTSW 16 93810204 missense probably benign 0.01
R8033:Dopey2 UTSW 16 93769483 missense probably benign
R8061:Dopey2 UTSW 16 93749996 missense probably damaging 1.00
R8067:Dopey2 UTSW 16 93765448 nonsense probably null
Z1088:Dopey2 UTSW 16 93763326 missense probably benign 0.00
Z1176:Dopey2 UTSW 16 93769581 missense probably benign 0.00
Z1176:Dopey2 UTSW 16 93803546 missense probably damaging 1.00
Z1176:Dopey2 UTSW 16 93807868 missense possibly damaging 0.82
Z1177:Dopey2 UTSW 16 93763895 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGGATTTCTGCTCAGGAG -3'
(R):5'- GTGCTCCAAAGACACTGGAAG -3'

Sequencing Primer
(F):5'- TCAGGAGCAGTGCCCTCATG -3'
(R):5'- TGCTCCAAAGACACTGGAAGTTAATG -3'
Posted On2014-07-14