Incidental Mutation 'R1917:Pdia2'
ID212652
Institutional Source Beutler Lab
Gene Symbol Pdia2
Ensembl Gene ENSMUSG00000024184
Gene Nameprotein disulfide isomerase associated 2
SynonymsPdipl, 1810041F13Rik, Pdip
MMRRC Submission 039935-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R1917 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location26195999-26199087 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26198105 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 122 (T122S)
Ref Sequence ENSEMBL: ENSMUSP00000114080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025019] [ENSMUST00000025020] [ENSMUST00000039113] [ENSMUST00000074370] [ENSMUST00000118904] [ENSMUST00000120333] [ENSMUST00000121959] [ENSMUST00000122058] [ENSMUST00000163421] [ENSMUST00000176961]
Predicted Effect probably benign
Transcript: ENSMUST00000025019
SMART Domains Protein: ENSMUSP00000025019
Gene: ENSMUSG00000073433

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
Pfam:Rho_GDI 29 222 1.2e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025020
SMART Domains Protein: ENSMUSP00000025020
Gene: ENSMUSG00000024186

DomainStartEndE-ValueType
DEP 34 109 7.78e-17 SMART
G_gamma 220 284 1.38e-19 SMART
GGL 223 284 1.1e-26 SMART
RGS 303 418 6.23e-47 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000039113
AA Change: T122S

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035584
Gene: ENSMUSG00000024184
AA Change: T122S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin 46 153 1.5e-26 PFAM
Pfam:Thioredoxin_6 182 369 3.2e-37 PFAM
Pfam:Thioredoxin 392 497 2.4e-27 PFAM
low complexity region 501 515 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074370
SMART Domains Protein: ENSMUSP00000073974
Gene: ENSMUSG00000024182

DomainStartEndE-ValueType
Pfam:AXIN1_TNKS_BD 13 85 7.5e-27 PFAM
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 523 3.2e-13 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
low complexity region 713 727 N/A INTRINSIC
DAX 786 868 5.92e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118904
SMART Domains Protein: ENSMUSP00000113756
Gene: ENSMUSG00000024182

DomainStartEndE-ValueType
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 502 1.2e-18 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
coiled coil region 712 734 N/A INTRINSIC
DAX 750 832 5.92e-45 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000120333
AA Change: T122S

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114080
Gene: ENSMUSG00000024184
AA Change: T122S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin 46 153 2.6e-27 PFAM
Pfam:Thioredoxin_6 181 366 2e-37 PFAM
Pfam:Thioredoxin 389 494 7.2e-28 PFAM
low complexity region 498 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121959
SMART Domains Protein: ENSMUSP00000113186
Gene: ENSMUSG00000073433

DomainStartEndE-ValueType
Pfam:Rho_GDI 14 197 6.4e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122058
SMART Domains Protein: ENSMUSP00000113885
Gene: ENSMUSG00000024186

DomainStartEndE-ValueType
DEP 32 107 7.78e-17 SMART
G_gamma 218 282 1.38e-19 SMART
GGL 221 282 1.1e-26 SMART
RGS 301 416 6.23e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127594
Predicted Effect unknown
Transcript: ENSMUST00000142410
AA Change: T113S
SMART Domains Protein: ENSMUSP00000115267
Gene: ENSMUSG00000024184
AA Change: T113S

DomainStartEndE-ValueType
Pfam:Thioredoxin 38 145 3.8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147220
Predicted Effect probably benign
Transcript: ENSMUST00000148134
SMART Domains Protein: ENSMUSP00000116340
Gene: ENSMUSG00000024184

DomainStartEndE-ValueType
Pfam:Thioredoxin 19 124 2e-28 PFAM
low complexity region 128 142 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155556
Predicted Effect probably benign
Transcript: ENSMUST00000163421
SMART Domains Protein: ENSMUSP00000132000
Gene: ENSMUSG00000024182

DomainStartEndE-ValueType
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 502 1.2e-18 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
coiled coil region 712 734 N/A INTRINSIC
DAX 750 832 5.92e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176847
Predicted Effect probably benign
Transcript: ENSMUST00000176961
SMART Domains Protein: ENSMUSP00000135717
Gene: ENSMUSG00000073433

DomainStartEndE-ValueType
Pfam:Rho_GDI 14 222 1.9e-83 PFAM
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.8%
  • 20x: 93.6%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, two catalytically active thioredoxin (TRX) domains, two TRX-like domains and a C-terminal ER-retention sequence. The protein plays a role in the folding of nascent proteins in the endoplasmic reticulum by forming disulfide bonds through its thiol isomerase, oxidase, and reductase activity. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik A G 11: 29,824,039 S473P probably benign Het
Abca8a A G 11: 110,091,515 probably benign Het
Adgre5 A G 8: 83,729,109 V190A probably damaging Het
Akap6 A G 12: 53,104,612 N1153S probably benign Het
Aldh1a7 G A 19: 20,727,455 H20Y probably benign Het
B430306N03Rik A G 17: 48,324,148 E278G probably benign Het
Cacna1b C A 2: 24,616,879 R72L probably null Het
Cc2d2a C G 5: 43,706,222 S675R probably damaging Het
Ccdc88b T A 19: 6,849,226 E1040D probably damaging Het
Cmtm7 A G 9: 114,763,364 V55A probably damaging Het
Coq4 A C 2: 29,789,926 T77P probably damaging Het
Cyp2j11 C A 4: 96,339,974 W136L probably damaging Het
Dctn2 T A 10: 127,275,049 Y86* probably null Het
Ddx56 A G 11: 6,263,937 probably null Het
Dopey2 T C 16: 93,716,262 S30P probably damaging Het
Ep400 T C 5: 110,703,575 K1347R unknown Het
Fat3 T A 9: 15,997,057 T2550S possibly damaging Het
Fcrla G T 1: 170,927,526 C5* probably null Het
Fermt1 T A 2: 132,922,842 D365V probably damaging Het
Fhod3 A G 18: 24,989,965 probably benign Het
Fhod3 A G 18: 25,085,601 D807G probably benign Het
Fnip1 C T 11: 54,480,684 T177I probably damaging Het
Gart T C 16: 91,628,149 Y662C probably damaging Het
Gda A T 19: 21,397,640 probably benign Het
Gk A G X: 85,760,580 I85T probably damaging Het
Gm12169 A G 11: 46,528,531 D58G possibly damaging Het
Gm14548 C T 7: 3,897,638 V38M probably damaging Het
Gm3476 A G 14: 6,118,358 L255P possibly damaging Het
Gm9966 T C 7: 95,958,477 C2R unknown Het
Gnpda1 T C 18: 38,333,190 probably null Het
Gtf2h4 G A 17: 35,670,198 L246F possibly damaging Het
Hao1 A T 2: 134,523,060 S216T probably benign Het
Hnrnpr C A 4: 136,332,488 S301* probably null Het
Hsd3b2 A G 3: 98,712,026 I201T probably benign Het
Jade2 T C 11: 51,818,538 E548G possibly damaging Het
Katnbl1 T C 2: 112,409,179 I241T probably benign Het
Keap1 G T 9: 21,233,806 Q299K probably benign Het
Kif1a T C 1: 93,019,031 I1650V possibly damaging Het
Lrba G A 3: 86,664,501 G275R probably damaging Het
Map3k9 C A 12: 81,780,790 E29* probably null Het
Mat1a G A 14: 41,121,437 V307I probably damaging Het
Mcm2 A T 6: 88,891,803 M324K possibly damaging Het
Metap1d T C 2: 71,511,527 V155A probably damaging Het
Mtbp A G 15: 55,564,677 probably benign Het
Myh14 T C 7: 44,657,925 T231A probably benign Het
Mylk4 A T 13: 32,724,853 D90E probably benign Het
Myo15b T A 11: 115,882,254 I1837K possibly damaging Het
Myo3a T A 2: 22,291,922 H242Q probably damaging Het
Nxn A G 11: 76,261,672 probably benign Het
Olfr791 T A 10: 129,527,049 V274D probably damaging Het
Pak3 C A X: 143,791,302 A553E possibly damaging Het
Plod2 A G 9: 92,581,257 T132A probably benign Het
Ptprz1 T A 6: 23,035,040 probably benign Het
Rad54b A C 4: 11,601,693 N416T probably damaging Het
Recql4 A T 15: 76,703,837 Y1142* probably null Het
Rnf216 A G 5: 142,992,806 V859A probably benign Het
Scnm1 G T 3: 95,130,273 P161T possibly damaging Het
Serpinb6b A G 13: 32,978,240 I222V probably benign Het
Serpinf1 A G 11: 75,411,007 I274T possibly damaging Het
Slc28a1 T C 7: 81,169,586 F641L probably benign Het
Slc8a2 A G 7: 16,152,920 I657V probably benign Het
Smchd1 A G 17: 71,407,237 I877T possibly damaging Het
Spata31 T C 13: 64,920,865 Y276H possibly damaging Het
Spire2 A G 8: 123,363,071 D447G probably benign Het
Stk3 G A 15: 35,073,217 T119I probably damaging Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Sult2a5 T C 7: 13,670,684 F282S probably damaging Het
Syk A T 13: 52,622,708 D248V probably damaging Het
Thoc6 C T 17: 23,669,390 probably benign Het
Tll2 T A 19: 41,128,497 D293V possibly damaging Het
Umodl1 G A 17: 30,984,043 V457M probably damaging Het
Usp19 T A 9: 108,499,325 C689* probably null Het
Usp24 T G 4: 106,410,286 V1955G probably damaging Het
Vmn1r226 T C 17: 20,687,580 S25P probably damaging Het
Vmn2r69 C T 7: 85,411,683 C231Y probably damaging Het
Wdr73 C T 7: 80,893,333 D176N probably benign Het
Wnt7b T A 15: 85,559,080 I41F probably damaging Het
Zfhx3 T C 8: 108,956,248 S3440P unknown Het
Zfp52 T G 17: 21,560,164 N91K probably benign Het
Zfp930 C A 8: 69,228,705 Q350K probably benign Het
Zfp949 T C 9: 88,570,062 S562P probably damaging Het
Other mutations in Pdia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Pdia2 APN 17 26198116 missense probably damaging 0.98
IGL01019:Pdia2 APN 17 26198922 missense probably damaging 1.00
IGL02289:Pdia2 APN 17 26197890 missense possibly damaging 0.66
IGL02725:Pdia2 APN 17 26196532 missense probably benign 0.05
R0553:Pdia2 UTSW 17 26196243 missense probably damaging 0.98
R0988:Pdia2 UTSW 17 26198829 missense probably damaging 1.00
R1624:Pdia2 UTSW 17 26196521 missense probably damaging 1.00
R3950:Pdia2 UTSW 17 26197616 critical splice donor site probably null
R4583:Pdia2 UTSW 17 26196502 missense probably damaging 1.00
R5455:Pdia2 UTSW 17 26197163 missense probably null 0.99
R6841:Pdia2 UTSW 17 26196604 splice site probably null
R6889:Pdia2 UTSW 17 26196970 nonsense probably null
R7312:Pdia2 UTSW 17 26197660 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- ATCAGTGCCTGGACACCTTC -3'
(R):5'- ATGTTCCCTGTTGGACCTGG -3'

Sequencing Primer
(F):5'- ATCCTCCAGATGTGTGGCACTG -3'
(R):5'- AGGACTGGTGTGCTCACAG -3'
Posted On2014-07-14