Mutagenetix > Incidental Mutation

Incidental Mutation 'R1917:Umodl1'

212653

Institutional Source

Beutler Lab

Gene Symbol

Umodl1

Ensembl Gene

ENSMUSG00000054134

Gene Name

uromodulin-like 1

Synonyms

D17Ertd488e

MMRRC Submission

039935-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1917 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30954679-31010708 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 30984043 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 457 (V457M)

Ref Sequence

ENSEMBL: ENSMUSP00000110202 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]

AlphaFold

Q5DID3

Predicted Effect

probably damaging
Transcript: ENSMUST00000066554
AA Change: V457M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: V457M

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000066981
AA Change: V457M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: V457M

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	8.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	8.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	619	632	N/A	INTRINSIC
SEA	706	821	8.88e-2	SMART
EGF	818	859	4.26e0	SMART
ZP	909	1152	5.44e-25	SMART
transmembrane domain	1186	1208	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000114555
AA Change: V457M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: V457M

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	9.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	9.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.8%
20x: 93.6%

Validation Efficiency

100% (83/83)

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931440F15Rik	A	G	11: 29,824,039	S473P	probably benign	Het
Abca8a	A	G	11: 110,091,515		probably benign	Het
Adgre5	A	G	8: 83,729,109	V190A	probably damaging	Het
Akap6	A	G	12: 53,104,612	N1153S	probably benign	Het
Aldh1a7	G	A	19: 20,727,455	H20Y	probably benign	Het
B430306N03Rik	A	G	17: 48,324,148	E278G	probably benign	Het
Cacna1b	C	A	2: 24,616,879	R72L	probably null	Het
Cc2d2a	C	G	5: 43,706,222	S675R	probably damaging	Het
Ccdc88b	T	A	19: 6,849,226	E1040D	probably damaging	Het
Cmtm7	A	G	9: 114,763,364	V55A	probably damaging	Het
Coq4	A	C	2: 29,789,926	T77P	probably damaging	Het
Cyp2j11	C	A	4: 96,339,974	W136L	probably damaging	Het
Dctn2	T	A	10: 127,275,049	Y86*	probably null	Het
Ddx56	A	G	11: 6,263,937		probably null	Het
Dopey2	T	C	16: 93,716,262	S30P	probably damaging	Het
Ep400	T	C	5: 110,703,575	K1347R	unknown	Het
Fat3	T	A	9: 15,997,057	T2550S	possibly damaging	Het
Fcrla	G	T	1: 170,927,526	C5*	probably null	Het
Fermt1	T	A	2: 132,922,842	D365V	probably damaging	Het
Fhod3	A	G	18: 24,989,965		probably benign	Het
Fhod3	A	G	18: 25,085,601	D807G	probably benign	Het
Fnip1	C	T	11: 54,480,684	T177I	probably damaging	Het
Gart	T	C	16: 91,628,149	Y662C	probably damaging	Het
Gda	A	T	19: 21,397,640		probably benign	Het
Gk	A	G	X: 85,760,580	I85T	probably damaging	Het
Gm12169	A	G	11: 46,528,531	D58G	possibly damaging	Het
Gm14548	C	T	7: 3,897,638	V38M	probably damaging	Het
Gm3476	A	G	14: 6,118,358	L255P	possibly damaging	Het
Gm9966	T	C	7: 95,958,477	C2R	unknown	Het
Gnpda1	T	C	18: 38,333,190		probably null	Het
Gtf2h4	G	A	17: 35,670,198	L246F	possibly damaging	Het
Hao1	A	T	2: 134,523,060	S216T	probably benign	Het
Hnrnpr	C	A	4: 136,332,488	S301*	probably null	Het
Hsd3b2	A	G	3: 98,712,026	I201T	probably benign	Het
Jade2	T	C	11: 51,818,538	E548G	possibly damaging	Het
Katnbl1	T	C	2: 112,409,179	I241T	probably benign	Het
Keap1	G	T	9: 21,233,806	Q299K	probably benign	Het
Kif1a	T	C	1: 93,019,031	I1650V	possibly damaging	Het
Lrba	G	A	3: 86,664,501	G275R	probably damaging	Het
Map3k9	C	A	12: 81,780,790	E29*	probably null	Het
Mat1a	G	A	14: 41,121,437	V307I	probably damaging	Het
Mcm2	A	T	6: 88,891,803	M324K	possibly damaging	Het
Metap1d	T	C	2: 71,511,527	V155A	probably damaging	Het
Mtbp	A	G	15: 55,564,677		probably benign	Het
Myh14	T	C	7: 44,657,925	T231A	probably benign	Het
Mylk4	A	T	13: 32,724,853	D90E	probably benign	Het
Myo15b	T	A	11: 115,882,254	I1837K	possibly damaging	Het
Myo3a	T	A	2: 22,291,922	H242Q	probably damaging	Het
Nxn	A	G	11: 76,261,672		probably benign	Het
Olfr791	T	A	10: 129,527,049	V274D	probably damaging	Het
Pak3	C	A	X: 143,791,302	A553E	possibly damaging	Het
Pdia2	T	A	17: 26,198,105	T122S	possibly damaging	Het
Plod2	A	G	9: 92,581,257	T132A	probably benign	Het
Ptprz1	T	A	6: 23,035,040		probably benign	Het
Rad54b	A	C	4: 11,601,693	N416T	probably damaging	Het
Recql4	A	T	15: 76,703,837	Y1142*	probably null	Het
Rnf216	A	G	5: 142,992,806	V859A	probably benign	Het
Scnm1	G	T	3: 95,130,273	P161T	possibly damaging	Het
Serpinb6b	A	G	13: 32,978,240	I222V	probably benign	Het
Serpinf1	A	G	11: 75,411,007	I274T	possibly damaging	Het
Slc28a1	T	C	7: 81,169,586	F641L	probably benign	Het
Slc8a2	A	G	7: 16,152,920	I657V	probably benign	Het
Smchd1	A	G	17: 71,407,237	I877T	possibly damaging	Het
Spata31	T	C	13: 64,920,865	Y276H	possibly damaging	Het
Spire2	A	G	8: 123,363,071	D447G	probably benign	Het
Stk3	G	A	15: 35,073,217	T119I	probably damaging	Het
Stxbp5	C	A	10: 9,812,298	V420F	possibly damaging	Het
Sult2a5	T	C	7: 13,670,684	F282S	probably damaging	Het
Syk	A	T	13: 52,622,708	D248V	probably damaging	Het
Thoc6	C	T	17: 23,669,390		probably benign	Het
Tll2	T	A	19: 41,128,497	D293V	possibly damaging	Het
Usp19	T	A	9: 108,499,325	C689*	probably null	Het
Usp24	T	G	4: 106,410,286	V1955G	probably damaging	Het
Vmn1r226	T	C	17: 20,687,580	S25P	probably damaging	Het
Vmn2r69	C	T	7: 85,411,683	C231Y	probably damaging	Het
Wdr73	C	T	7: 80,893,333	D176N	probably benign	Het
Wnt7b	T	A	15: 85,559,080	I41F	probably damaging	Het
Zfhx3	T	C	8: 108,956,248	S3440P	unknown	Het
Zfp52	T	G	17: 21,560,164	N91K	probably benign	Het
Zfp930	C	A	8: 69,228,705	Q350K	probably benign	Het
Zfp949	T	C	9: 88,570,062	S562P	probably damaging	Het

Other mutations in Umodl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00915:Umodl1	APN	17	31008750	utr 3 prime	probably benign
IGL01344:Umodl1	APN	17	30996264	missense	probably damaging	0.99
IGL01529:Umodl1	APN	17	30996259	missense	possibly damaging	0.94
IGL01609:Umodl1	APN	17	30998826	missense	possibly damaging	0.90
IGL01625:Umodl1	APN	17	30996255	missense	probably benign	0.00
IGL01877:Umodl1	APN	17	30982320	missense	probably benign	0.00
IGL01977:Umodl1	APN	17	30973768	missense	probably damaging	0.99
IGL02063:Umodl1	APN	17	30987914	missense	probably benign	0.07
IGL02160:Umodl1	APN	17	30986117	missense	probably damaging	0.97
IGL02252:Umodl1	APN	17	30994815	critical splice donor site	probably null
IGL02427:Umodl1	APN	17	30968441	splice site	probably benign
IGL02496:Umodl1	APN	17	30998654	missense	probably damaging	0.99
IGL02633:Umodl1	APN	17	30989488	missense	probably damaging	1.00
IGL03271:Umodl1	APN	17	30986499	nonsense	probably null
IGL03392:Umodl1	APN	17	30996355	missense	probably damaging	0.98
Disquieting	UTSW	17	30959155	missense	probably damaging	1.00
floored	UTSW	17	30988057	nonsense	probably null
R7231_umodl1_507	UTSW	17	30986116	missense	probably damaging	1.00
surprising	UTSW	17	30986465	missense	possibly damaging	0.77
unsettling	UTSW	17	30986554	nonsense	probably null
G1citation:Umodl1	UTSW	17	30986554	nonsense	probably null
PIT4468001:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0653:Umodl1	UTSW	17	30984028	missense	probably benign	0.00
R0831:Umodl1	UTSW	17	30996351	missense	probably damaging	1.00
R1078:Umodl1	UTSW	17	30959373	missense	probably benign	0.00
R1166:Umodl1	UTSW	17	31002798	splice site	probably benign
R1231:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R1459:Umodl1	UTSW	17	30982258	splice site	probably benign
R1459:Umodl1	UTSW	17	30986504	missense	probably benign	0.05
R1510:Umodl1	UTSW	17	30959229	missense	probably damaging	1.00
R1654:Umodl1	UTSW	17	30987968	missense	probably benign
R1757:Umodl1	UTSW	17	31008700	missense	probably damaging	0.99
R1781:Umodl1	UTSW	17	30968550	missense	probably damaging	1.00
R1873:Umodl1	UTSW	17	30982264	missense	probably damaging	0.99
R1911:Umodl1	UTSW	17	30992154	missense	possibly damaging	0.74
R1918:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R2057:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2058:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2089:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2431:Umodl1	UTSW	17	30992088	missense	possibly damaging	0.79
R2903:Umodl1	UTSW	17	30992173	missense	probably damaging	1.00
R3032:Umodl1	UTSW	17	30989528	missense	probably benign	0.01
R3956:Umodl1	UTSW	17	31002863	missense	probably benign	0.10
R3975:Umodl1	UTSW	17	30984789	nonsense	probably null
R4207:Umodl1	UTSW	17	30959367	missense	probably damaging	1.00
R4287:Umodl1	UTSW	17	30988065	missense	probably benign	0.11
R4452:Umodl1	UTSW	17	30994815	critical splice donor site	probably null
R4684:Umodl1	UTSW	17	30998114	missense	probably benign	0.00
R4769:Umodl1	UTSW	17	30984002	missense	possibly damaging	0.92
R4887:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R4888:Umodl1	UTSW	17	30999201	missense	probably damaging	1.00
R4978:Umodl1	UTSW	17	30986081	missense	probably benign
R4993:Umodl1	UTSW	17	30986485	missense	probably benign	0.00
R5241:Umodl1	UTSW	17	30984092	missense	probably benign	0.18
R5254:Umodl1	UTSW	17	30980359	missense	possibly damaging	0.86
R5454:Umodl1	UTSW	17	30986465	missense	possibly damaging	0.77
R5456:Umodl1	UTSW	17	30982289	missense	probably benign	0.04
R5754:Umodl1	UTSW	17	30994787	missense	probably damaging	0.96
R6189:Umodl1	UTSW	17	30996282	missense	possibly damaging	0.75
R6222:Umodl1	UTSW	17	31002892	critical splice donor site	probably null
R6289:Umodl1	UTSW	17	30982351	missense	probably benign	0.16
R6432:Umodl1	UTSW	17	30986147	missense	probably benign	0.38
R6478:Umodl1	UTSW	17	30959155	missense	probably damaging	1.00
R6702:Umodl1	UTSW	17	30986299	splice site	probably null
R6822:Umodl1	UTSW	17	30986554	nonsense	probably null
R6999:Umodl1	UTSW	17	30999123	missense	probably damaging	1.00
R7067:Umodl1	UTSW	17	30982272	missense	probably damaging	1.00
R7123:Umodl1	UTSW	17	30982344	missense	possibly damaging	0.90
R7219:Umodl1	UTSW	17	30982262	critical splice acceptor site	probably null
R7231:Umodl1	UTSW	17	30986116	missense	probably damaging	1.00
R7234:Umodl1	UTSW	17	30986621	missense	possibly damaging	0.87
R7297:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R7392:Umodl1	UTSW	17	30982332	missense	probably damaging	0.99
R7401:Umodl1	UTSW	17	30998148	missense	probably damaging	1.00
R7461:Umodl1	UTSW	17	30988057	nonsense	probably null
R7594:Umodl1	UTSW	17	30954805	missense	probably benign	0.02
R7613:Umodl1	UTSW	17	30988057	nonsense	probably null
R7763:Umodl1	UTSW	17	30986456	missense	probably benign	0.24
R7797:Umodl1	UTSW	17	30959151	missense	probably benign	0.02
R7832:Umodl1	UTSW	17	30973692	critical splice acceptor site	probably null
R7954:Umodl1	UTSW	17	30986387	missense	probably benign	0.00
R8088:Umodl1	UTSW	17	30973796	missense	probably benign	0.29
R8111:Umodl1	UTSW	17	30971818	missense	probably damaging	0.99
R8314:Umodl1	UTSW	17	30984832	missense	probably damaging	0.99
R8826:Umodl1	UTSW	17	30983984	missense	possibly damaging	0.65
R9067:Umodl1	UTSW	17	30973703	missense	probably damaging	1.00
R9091:Umodl1	UTSW	17	30966704	missense	probably damaging	1.00
R9099:Umodl1	UTSW	17	30959173	missense	probably benign	0.01
R9270:Umodl1	UTSW	17	30966704	missense	probably damaging	1.00
R9341:Umodl1	UTSW	17	30998727	missense	possibly damaging	0.95
R9343:Umodl1	UTSW	17	30998727	missense	possibly damaging	0.95
R9400:Umodl1	UTSW	17	30996393	missense	probably damaging	0.99
R9569:Umodl1	UTSW	17	30998169	missense	probably damaging	1.00
R9615:Umodl1	UTSW	17	30998178	missense	possibly damaging	0.94
R9787:Umodl1	UTSW	17	30959350	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGTCCATGAGTAGCCAGAG -3'
(R):5'- AACTTGTGAGCCCCATTGC -3'

Sequencing Primer
(F):5'- TGGGACTCCACAGCTGTTC -3'
(R):5'- TGAGCCCCATTGCCCTAAGAG -3'

Posted On

2014-07-14