Incidental Mutation 'R1917:Ccdc88b'
ID 212660
Institutional Source Beutler Lab
Gene Symbol Ccdc88b
Ensembl Gene ENSMUSG00000047810
Gene Name coiled-coil domain containing 88B
Synonyms
MMRRC Submission 039935-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1917 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 6844623-6858211 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 6849226 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1040 (E1040D)
Ref Sequence ENSEMBL: ENSMUSP00000109067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113440]
AlphaFold Q4QRL3
Predicted Effect probably damaging
Transcript: ENSMUST00000113440
AA Change: E1040D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109067
Gene: ENSMUSG00000047810
AA Change: E1040D

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 29 50 N/A INTRINSIC
Pfam:HOOK 91 503 1.2e-16 PFAM
coiled coil region 731 1308 N/A INTRINSIC
low complexity region 1420 1429 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.8%
  • 20x: 93.6%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hook-related protein family. Members of this family are characterized by an N-terminal potential microtubule binding domain, a central coiled-coiled and a C-terminal Hook-related domain. The encoded protein may be involved in linking organelles to microtubules. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null ENU-induced allele exhibit decreased susceptibility to P. berghei infection with reduced T cell proliferation, decreased cytokine secretion and increased myeloid cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik A G 11: 29,824,039 S473P probably benign Het
Abca8a A G 11: 110,091,515 probably benign Het
Adgre5 A G 8: 83,729,109 V190A probably damaging Het
Akap6 A G 12: 53,104,612 N1153S probably benign Het
Aldh1a7 G A 19: 20,727,455 H20Y probably benign Het
B430306N03Rik A G 17: 48,324,148 E278G probably benign Het
Cacna1b C A 2: 24,616,879 R72L probably null Het
Cc2d2a C G 5: 43,706,222 S675R probably damaging Het
Cmtm7 A G 9: 114,763,364 V55A probably damaging Het
Coq4 A C 2: 29,789,926 T77P probably damaging Het
Cyp2j11 C A 4: 96,339,974 W136L probably damaging Het
Dctn2 T A 10: 127,275,049 Y86* probably null Het
Ddx56 A G 11: 6,263,937 probably null Het
Dopey2 T C 16: 93,716,262 S30P probably damaging Het
Ep400 T C 5: 110,703,575 K1347R unknown Het
Fat3 T A 9: 15,997,057 T2550S possibly damaging Het
Fcrla G T 1: 170,927,526 C5* probably null Het
Fermt1 T A 2: 132,922,842 D365V probably damaging Het
Fhod3 A G 18: 24,989,965 probably benign Het
Fhod3 A G 18: 25,085,601 D807G probably benign Het
Fnip1 C T 11: 54,480,684 T177I probably damaging Het
Gart T C 16: 91,628,149 Y662C probably damaging Het
Gda A T 19: 21,397,640 probably benign Het
Gk A G X: 85,760,580 I85T probably damaging Het
Gm12169 A G 11: 46,528,531 D58G possibly damaging Het
Gm14548 C T 7: 3,897,638 V38M probably damaging Het
Gm3476 A G 14: 6,118,358 L255P possibly damaging Het
Gm9966 T C 7: 95,958,477 C2R unknown Het
Gnpda1 T C 18: 38,333,190 probably null Het
Gtf2h4 G A 17: 35,670,198 L246F possibly damaging Het
Hao1 A T 2: 134,523,060 S216T probably benign Het
Hnrnpr C A 4: 136,332,488 S301* probably null Het
Hsd3b2 A G 3: 98,712,026 I201T probably benign Het
Jade2 T C 11: 51,818,538 E548G possibly damaging Het
Katnbl1 T C 2: 112,409,179 I241T probably benign Het
Keap1 G T 9: 21,233,806 Q299K probably benign Het
Kif1a T C 1: 93,019,031 I1650V possibly damaging Het
Lrba G A 3: 86,664,501 G275R probably damaging Het
Map3k9 C A 12: 81,780,790 E29* probably null Het
Mat1a G A 14: 41,121,437 V307I probably damaging Het
Mcm2 A T 6: 88,891,803 M324K possibly damaging Het
Metap1d T C 2: 71,511,527 V155A probably damaging Het
Mtbp A G 15: 55,564,677 probably benign Het
Myh14 T C 7: 44,657,925 T231A probably benign Het
Mylk4 A T 13: 32,724,853 D90E probably benign Het
Myo15b T A 11: 115,882,254 I1837K possibly damaging Het
Myo3a T A 2: 22,291,922 H242Q probably damaging Het
Nxn A G 11: 76,261,672 probably benign Het
Olfr791 T A 10: 129,527,049 V274D probably damaging Het
Pak3 C A X: 143,791,302 A553E possibly damaging Het
Pdia2 T A 17: 26,198,105 T122S possibly damaging Het
Plod2 A G 9: 92,581,257 T132A probably benign Het
Ptprz1 T A 6: 23,035,040 probably benign Het
Rad54b A C 4: 11,601,693 N416T probably damaging Het
Recql4 A T 15: 76,703,837 Y1142* probably null Het
Rnf216 A G 5: 142,992,806 V859A probably benign Het
Scnm1 G T 3: 95,130,273 P161T possibly damaging Het
Serpinb6b A G 13: 32,978,240 I222V probably benign Het
Serpinf1 A G 11: 75,411,007 I274T possibly damaging Het
Slc28a1 T C 7: 81,169,586 F641L probably benign Het
Slc8a2 A G 7: 16,152,920 I657V probably benign Het
Smchd1 A G 17: 71,407,237 I877T possibly damaging Het
Spata31 T C 13: 64,920,865 Y276H possibly damaging Het
Spire2 A G 8: 123,363,071 D447G probably benign Het
Stk3 G A 15: 35,073,217 T119I probably damaging Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Sult2a5 T C 7: 13,670,684 F282S probably damaging Het
Syk A T 13: 52,622,708 D248V probably damaging Het
Thoc6 C T 17: 23,669,390 probably benign Het
Tll2 T A 19: 41,128,497 D293V possibly damaging Het
Umodl1 G A 17: 30,984,043 V457M probably damaging Het
Usp19 T A 9: 108,499,325 C689* probably null Het
Usp24 T G 4: 106,410,286 V1955G probably damaging Het
Vmn1r226 T C 17: 20,687,580 S25P probably damaging Het
Vmn2r69 C T 7: 85,411,683 C231Y probably damaging Het
Wdr73 C T 7: 80,893,333 D176N probably benign Het
Wnt7b T A 15: 85,559,080 I41F probably damaging Het
Zfhx3 T C 8: 108,956,248 S3440P unknown Het
Zfp52 T G 17: 21,560,164 N91K probably benign Het
Zfp930 C A 8: 69,228,705 Q350K probably benign Het
Zfp949 T C 9: 88,570,062 S562P probably damaging Het
Other mutations in Ccdc88b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Ccdc88b APN 19 6845086 missense probably damaging 1.00
IGL01637:Ccdc88b APN 19 6846710 missense probably benign 0.13
IGL02201:Ccdc88b APN 19 6846631 missense probably damaging 1.00
IGL02260:Ccdc88b APN 19 6855349 splice site probably benign
IGL02276:Ccdc88b APN 19 6856107 critical splice donor site probably null
IGL02412:Ccdc88b APN 19 6846644 missense probably damaging 1.00
IGL02420:Ccdc88b APN 19 6856949 missense probably damaging 1.00
IGL02990:Ccdc88b APN 19 6847409 missense probably damaging 1.00
R0031:Ccdc88b UTSW 19 6853783 missense possibly damaging 0.93
R0544:Ccdc88b UTSW 19 6857266 missense probably damaging 1.00
R0727:Ccdc88b UTSW 19 6854214 missense probably benign
R0920:Ccdc88b UTSW 19 6846649 missense probably benign
R0975:Ccdc88b UTSW 19 6846625 missense probably damaging 1.00
R1170:Ccdc88b UTSW 19 6853213 missense probably damaging 1.00
R1363:Ccdc88b UTSW 19 6850371 missense possibly damaging 0.55
R1471:Ccdc88b UTSW 19 6854023 missense probably benign
R1605:Ccdc88b UTSW 19 6850469 missense probably benign 0.06
R1752:Ccdc88b UTSW 19 6853322 missense probably benign 0.02
R1832:Ccdc88b UTSW 19 6853532 nonsense probably null
R1839:Ccdc88b UTSW 19 6854109 splice site probably benign
R2167:Ccdc88b UTSW 19 6854084 missense possibly damaging 0.52
R4012:Ccdc88b UTSW 19 6848991 missense probably damaging 0.98
R4350:Ccdc88b UTSW 19 6850272 missense probably damaging 0.97
R4427:Ccdc88b UTSW 19 6850572 missense probably damaging 0.99
R4676:Ccdc88b UTSW 19 6853000 missense probably benign 0.00
R4677:Ccdc88b UTSW 19 6848268 missense probably damaging 0.98
R4720:Ccdc88b UTSW 19 6857715 missense probably damaging 1.00
R4725:Ccdc88b UTSW 19 6857113 missense probably damaging 1.00
R4747:Ccdc88b UTSW 19 6856141 missense probably damaging 1.00
R5092:Ccdc88b UTSW 19 6848232 missense probably damaging 0.99
R5403:Ccdc88b UTSW 19 6857740 missense unknown
R5448:Ccdc88b UTSW 19 6854580 missense probably damaging 1.00
R5771:Ccdc88b UTSW 19 6853835 missense probably benign
R5783:Ccdc88b UTSW 19 6853916 missense probably benign 0.19
R5988:Ccdc88b UTSW 19 6855980 missense probably damaging 1.00
R6328:Ccdc88b UTSW 19 6849038 missense probably damaging 1.00
R6459:Ccdc88b UTSW 19 6854878 missense possibly damaging 0.92
R6773:Ccdc88b UTSW 19 6849041 missense possibly damaging 0.71
R7073:Ccdc88b UTSW 19 6853962 missense probably benign 0.34
R7707:Ccdc88b UTSW 19 6857469 missense probably benign 0.23
R7810:Ccdc88b UTSW 19 6849086 missense probably benign
R8298:Ccdc88b UTSW 19 6850281 missense probably damaging 0.97
R8349:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R8449:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R8481:Ccdc88b UTSW 19 6854532 missense probably damaging 1.00
R8506:Ccdc88b UTSW 19 6847322 missense probably damaging 0.99
R8714:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R8715:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R8717:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R8753:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R8754:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R8774:Ccdc88b UTSW 19 6847722 missense probably damaging 1.00
R8774-TAIL:Ccdc88b UTSW 19 6847722 missense probably damaging 1.00
R8787:Ccdc88b UTSW 19 6847423 missense probably damaging 1.00
R8896:Ccdc88b UTSW 19 6853835 missense probably benign
R9049:Ccdc88b UTSW 19 6849074 missense probably benign 0.37
R9100:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R9113:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R9197:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R9198:Ccdc88b UTSW 19 6853900 missense possibly damaging 0.92
R9198:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R9202:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R9323:Ccdc88b UTSW 19 6849107 missense probably damaging 1.00
R9334:Ccdc88b UTSW 19 6856173 missense possibly damaging 0.50
R9385:Ccdc88b UTSW 19 6856165 missense probably benign 0.13
R9441:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R9442:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
X0021:Ccdc88b UTSW 19 6853831 missense probably benign
Z1176:Ccdc88b UTSW 19 6849740 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GCTCGCATATTGGCCTTGAG -3'
(R):5'- ACACTAGCCGTTAGTCCTCAC -3'

Sequencing Primer
(F):5'- CGCATATTGGCCTTGAGATCTCG -3'
(R):5'- TGGGTCTCTTGCATGGCCC -3'
Posted On 2014-07-14