Incidental Mutation 'R1918:Ccdc148'
ID 212670
Institutional Source Beutler Lab
Gene Symbol Ccdc148
Ensembl Gene ENSMUSG00000036641
Gene Name coiled-coil domain containing 148
Synonyms
MMRRC Submission 039936-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.075) question?
Stock # R1918 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 58711082-58991027 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 58872911 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 299 (R299S)
Ref Sequence ENSEMBL: ENSMUSP00000153944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077687] [ENSMUST00000226455]
AlphaFold Q6P5U8
Predicted Effect probably damaging
Transcript: ENSMUST00000077687
AA Change: R227S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000076871
Gene: ENSMUSG00000036641
AA Change: R227S

DomainStartEndE-ValueType
coiled coil region 173 195 N/A INTRINSIC
coiled coil region 289 353 N/A INTRINSIC
low complexity region 369 382 N/A INTRINSIC
coiled coil region 401 438 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226455
AA Change: R299S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1500 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.5%
Validation Efficiency 97% (113/116)
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T G 7: 29,273,514 (GRCm39) noncoding transcript Het
A2m T C 6: 121,621,895 (GRCm39) S314P probably benign Het
Abcc9 T A 6: 142,643,408 (GRCm39) I47F probably damaging Het
Abcd2 C T 15: 91,075,684 (GRCm39) R43H probably benign Het
Adgre5 A G 8: 84,455,738 (GRCm39) V190A probably damaging Het
Aen C T 7: 78,555,777 (GRCm39) H242Y possibly damaging Het
Arfgef1 C T 1: 10,270,103 (GRCm39) A349T probably benign Het
Arhgap10 T C 8: 77,985,708 (GRCm39) I698V probably benign Het
Arpp21 C T 9: 111,948,246 (GRCm39) probably benign Het
Atp10a T C 7: 58,477,683 (GRCm39) I1294T possibly damaging Het
Atp13a2 T C 4: 140,723,682 (GRCm39) Y337H possibly damaging Het
Bsn C T 9: 107,984,772 (GRCm39) G3094D unknown Het
Cadm2 G A 16: 66,544,270 (GRCm39) probably benign Het
Cadps T C 14: 12,546,372 (GRCm38) M495V probably damaging Het
Cass4 A G 2: 172,269,259 (GRCm39) H447R possibly damaging Het
Ccdc124 C A 8: 71,321,588 (GRCm39) R108L probably benign Het
Ccdc141 C T 2: 76,845,047 (GRCm39) R1340Q probably benign Het
Cd300lg A G 11: 101,944,936 (GRCm39) E382G probably damaging Het
Cd36 A T 5: 18,002,034 (GRCm39) C322* probably null Het
Celsr2 C T 3: 108,305,966 (GRCm39) G2046D probably benign Het
Clasrp C T 7: 19,319,188 (GRCm39) W492* probably null Het
Cmtr1 T C 17: 29,897,983 (GRCm39) V154A possibly damaging Het
Ctnnb1 C T 9: 120,780,100 (GRCm39) P128S possibly damaging Het
Cyp11a1 A G 9: 57,934,040 (GRCm39) I496V probably damaging Het
Disp2 G A 2: 118,622,408 (GRCm39) V1047I probably benign Het
Dync2i1 A C 12: 116,196,221 (GRCm39) S509A probably damaging Het
Eps8l2 T C 7: 140,941,637 (GRCm39) V636A probably damaging Het
Fars2 T C 13: 36,388,529 (GRCm39) L6P probably damaging Het
Fem1al A G 11: 29,774,039 (GRCm39) S473P probably benign Het
Fnip1 C T 11: 54,371,510 (GRCm39) T177I probably damaging Het
Fut8 G T 12: 77,378,992 (GRCm39) R31L probably benign Het
G6pd2 T C 5: 61,967,664 (GRCm39) F480L probably benign Het
Glipr1l2 T A 10: 111,928,550 (GRCm39) C148* probably null Het
Gm10142 G A 10: 77,551,821 (GRCm39) V61M probably benign Het
Gm5134 T A 10: 75,812,180 (GRCm39) M145K possibly damaging Het
Gnpda1 T C 18: 38,466,243 (GRCm39) probably null Het
Gpc2 T C 5: 138,276,641 (GRCm39) T162A probably benign Het
Gtf2h4 G A 17: 35,981,090 (GRCm39) L246F possibly damaging Het
Hal C T 10: 93,332,469 (GRCm39) P294S probably damaging Het
Hectd3 C T 4: 116,857,540 (GRCm39) A573V possibly damaging Het
Hephl1 T A 9: 14,988,114 (GRCm39) I665F probably benign Het
Herc1 T C 9: 66,383,408 (GRCm39) probably null Het
Hif1an A G 19: 44,559,551 (GRCm39) probably null Het
Iho1 T A 9: 108,290,184 (GRCm39) H140L probably benign Het
Il12rb1 T A 8: 71,266,324 (GRCm39) M223K probably benign Het
Ilf3 C T 9: 21,305,010 (GRCm39) T201M probably damaging Het
Inpp5f T C 7: 128,265,693 (GRCm39) probably benign Het
Jcad T C 18: 4,674,292 (GRCm39) Y685H probably damaging Het
Kcnj1 C A 9: 32,308,034 (GRCm39) Q153K probably benign Het
Kctd18 A C 1: 57,998,379 (GRCm39) H73Q probably damaging Het
Klhl36 T A 8: 120,603,463 (GRCm39) W573R probably damaging Het
Ldc1 A T 4: 130,105,186 (GRCm39) V328D probably benign Het
Lepr A G 4: 101,630,033 (GRCm39) T583A probably benign Het
Ltbp4 G A 7: 27,036,994 (GRCm39) probably benign Het
Mapt A T 11: 104,189,325 (GRCm39) E114D probably benign Het
Mib1 T A 18: 10,740,972 (GRCm39) probably null Het
Mthfd1 G T 12: 76,361,750 (GRCm39) A119S probably damaging Het
Mylk4 A T 13: 32,908,836 (GRCm39) D90E probably benign Het
Nceh1 T G 3: 27,237,324 (GRCm39) L33R probably damaging Het
Nfat5 T C 8: 108,092,868 (GRCm39) I91T probably damaging Het
Nxn A G 11: 76,152,498 (GRCm39) probably benign Het
Oasl1 G A 5: 115,061,528 (GRCm39) A20T possibly damaging Het
Or2m12 A T 16: 19,105,052 (GRCm39) M147K probably benign Het
Or4c127 T C 2: 89,832,918 (GRCm39) F56S probably benign Het
Or4d6 A G 19: 12,086,871 (GRCm39) V13A probably benign Het
Or5b97 A G 19: 12,878,215 (GRCm39) *310Q probably null Het
Or5t18 C T 2: 86,637,171 (GRCm39) M57I probably damaging Het
Or6c2 T A 10: 129,362,918 (GRCm39) V274D probably damaging Het
Pepd T C 7: 34,671,101 (GRCm39) V215A probably benign Het
Pfkl A T 10: 77,837,260 (GRCm39) N104K probably damaging Het
Phf24 T C 4: 42,938,165 (GRCm39) probably benign Het
Pink1 T C 4: 138,041,331 (GRCm39) N530S probably benign Het
Pou3f2 T C 4: 22,487,119 (GRCm39) D338G probably damaging Het
Ppp1r13b A G 12: 111,801,244 (GRCm39) V480A probably damaging Het
Ptgfrn A T 3: 100,963,623 (GRCm39) I663N probably benign Het
Rad54b A C 4: 11,601,693 (GRCm39) N416T probably damaging Het
Rasef A G 4: 73,662,351 (GRCm39) S200P possibly damaging Het
Rbm33 T A 5: 28,592,915 (GRCm39) I605N probably damaging Het
Rps19bp1 T C 15: 80,148,280 (GRCm39) T31A probably benign Het
Ryr2 T A 13: 11,571,584 (GRCm39) T4885S possibly damaging Het
Serpinb6b A G 13: 33,162,223 (GRCm39) I222V probably benign Het
Sik3 C G 9: 46,132,387 (GRCm39) H1276Q probably benign Het
Skor2 T C 18: 76,947,051 (GRCm39) S258P unknown Het
Slc22a29 C T 19: 8,195,123 (GRCm39) probably null Het
Slc8a3 A T 12: 81,361,618 (GRCm39) F400L probably damaging Het
Slc9a8 T C 2: 167,266,134 (GRCm39) I37T possibly damaging Het
Smchd1 A G 17: 71,714,232 (GRCm39) I877T possibly damaging Het
Spag5 A G 11: 78,195,002 (GRCm39) N103S probably benign Het
Sptbn1 A T 11: 30,092,414 (GRCm39) F450L probably damaging Het
Strn4 T A 7: 16,567,846 (GRCm39) Y507N probably damaging Het
Stxbp5 C A 10: 9,688,042 (GRCm39) V420F possibly damaging Het
Syt17 G T 7: 118,033,208 (GRCm39) L267I possibly damaging Het
Tcstv4 T C 13: 120,769,758 (GRCm39) L26P probably damaging Het
Tdo2 T A 3: 81,866,247 (GRCm39) R339W probably damaging Het
Tex55 A G 16: 38,648,450 (GRCm39) Y220H possibly damaging Het
Timd5 A G 11: 46,419,358 (GRCm39) D58G possibly damaging Het
Ttn A G 2: 76,571,745 (GRCm39) S26383P probably damaging Het
Ttn G T 2: 76,638,868 (GRCm39) T13938K probably damaging Het
Tulp2 A G 7: 45,167,365 (GRCm39) N188D possibly damaging Het
Ube3c C T 5: 29,792,315 (GRCm39) R37C probably damaging Het
Uggt2 G T 14: 119,245,467 (GRCm39) probably benign Het
Umodl1 G A 17: 31,203,017 (GRCm39) V457M probably damaging Het
Usp17la C T 7: 104,509,953 (GRCm39) T186I probably benign Het
Vmn1r226 T C 17: 20,907,842 (GRCm39) S25P probably damaging Het
Vmn1r235 T A 17: 21,482,659 (GRCm39) I328K possibly damaging Het
Vmn2r50 A T 7: 9,781,610 (GRCm39) S378R probably benign Het
Vwa2 C T 19: 56,897,366 (GRCm39) T557I probably benign Het
Vxn T C 1: 9,671,852 (GRCm39) F15S probably damaging Het
Yes1 G T 5: 32,842,079 (GRCm39) Q534H probably benign Het
Zbtb25 A T 12: 76,396,075 (GRCm39) Y382* probably null Het
Zc3h3 G A 15: 75,648,967 (GRCm39) P722S probably damaging Het
Zfp36l2 T C 17: 84,494,164 (GRCm39) T158A probably damaging Het
Zfp536 T C 7: 37,179,624 (GRCm39) T994A probably damaging Het
Zfp592 C T 7: 80,687,168 (GRCm39) Q824* probably null Het
Zfp629 C A 7: 127,211,172 (GRCm39) K212N probably damaging Het
Zfp930 C A 8: 69,681,357 (GRCm39) Q350K probably benign Het
Other mutations in Ccdc148
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Ccdc148 APN 2 58,719,811 (GRCm39) missense probably benign 0.00
IGL02056:Ccdc148 APN 2 58,894,081 (GRCm39) splice site probably benign
IGL02470:Ccdc148 APN 2 58,891,911 (GRCm39) missense probably damaging 0.96
PIT4585001:Ccdc148 UTSW 2 58,872,988 (GRCm39) missense probably benign 0.01
R0068:Ccdc148 UTSW 2 58,717,629 (GRCm39) missense probably benign
R0068:Ccdc148 UTSW 2 58,717,629 (GRCm39) missense probably benign
R0348:Ccdc148 UTSW 2 58,894,084 (GRCm39) splice site probably null
R1464:Ccdc148 UTSW 2 58,824,455 (GRCm39) missense probably damaging 1.00
R1464:Ccdc148 UTSW 2 58,824,455 (GRCm39) missense probably damaging 1.00
R1464:Ccdc148 UTSW 2 58,796,374 (GRCm39) nonsense probably null
R1464:Ccdc148 UTSW 2 58,796,374 (GRCm39) nonsense probably null
R1675:Ccdc148 UTSW 2 58,870,566 (GRCm39) missense probably damaging 0.96
R1677:Ccdc148 UTSW 2 58,892,176 (GRCm39) missense probably damaging 1.00
R1832:Ccdc148 UTSW 2 58,891,911 (GRCm39) missense probably damaging 0.96
R2114:Ccdc148 UTSW 2 58,892,128 (GRCm39) missense probably damaging 1.00
R2115:Ccdc148 UTSW 2 58,892,128 (GRCm39) missense probably damaging 1.00
R4657:Ccdc148 UTSW 2 58,891,900 (GRCm39) missense probably benign 0.04
R4921:Ccdc148 UTSW 2 58,719,814 (GRCm39) missense probably damaging 1.00
R5022:Ccdc148 UTSW 2 58,717,644 (GRCm39) missense probably damaging 1.00
R5809:Ccdc148 UTSW 2 58,713,657 (GRCm39) missense probably damaging 1.00
R6164:Ccdc148 UTSW 2 58,713,645 (GRCm39) missense probably damaging 1.00
R6952:Ccdc148 UTSW 2 58,713,657 (GRCm39) missense probably damaging 1.00
R6987:Ccdc148 UTSW 2 58,872,926 (GRCm39) missense probably damaging 1.00
R7121:Ccdc148 UTSW 2 58,717,579 (GRCm39) missense probably damaging 1.00
R7452:Ccdc148 UTSW 2 58,717,596 (GRCm39) missense probably damaging 1.00
R7493:Ccdc148 UTSW 2 58,899,160 (GRCm39) missense probably damaging 1.00
R7574:Ccdc148 UTSW 2 58,713,645 (GRCm39) missense probably damaging 1.00
R7666:Ccdc148 UTSW 2 58,824,512 (GRCm39) missense probably damaging 0.99
R7763:Ccdc148 UTSW 2 58,713,648 (GRCm39) missense probably benign
R8045:Ccdc148 UTSW 2 58,892,083 (GRCm39) critical splice donor site probably null
R8865:Ccdc148 UTSW 2 58,719,832 (GRCm39) missense possibly damaging 0.86
R8932:Ccdc148 UTSW 2 58,894,054 (GRCm39) missense probably benign 0.40
R9597:Ccdc148 UTSW 2 58,893,397 (GRCm39) missense probably benign 0.08
X0062:Ccdc148 UTSW 2 58,893,460 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGTGGGTTTGCAGCCTATAAC -3'
(R):5'- ACGATCTTCACTGGCCGATAG -3'

Sequencing Primer
(F):5'- GTGGGTTTGCAGCCTATAACTAAACC -3'
(R):5'- TCACTGGCCGATAGCTTGAACAG -3'
Posted On 2014-07-14