Incidental Mutation 'R1918:Zfp592'
ID212714
Institutional Source Beutler Lab
Gene Symbol Zfp592
Ensembl Gene ENSMUSG00000005621
Gene Namezinc finger protein 592
Synonyms
MMRRC Submission 039936-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.885) question?
Stock #R1918 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location80993681-81045164 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 81037420 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 824 (Q824*)
Ref Sequence ENSEMBL: ENSMUSP00000102976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107353]
Predicted Effect probably null
Transcript: ENSMUST00000107353
AA Change: Q824*
SMART Domains Protein: ENSMUSP00000102976
Gene: ENSMUSG00000005621
AA Change: Q824*

DomainStartEndE-ValueType
low complexity region 170 180 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 314 333 N/A INTRINSIC
low complexity region 343 369 N/A INTRINSIC
low complexity region 484 500 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
ZnF_C2H2 587 612 8.98e0 SMART
ZnF_C2H2 615 639 2.61e1 SMART
low complexity region 664 686 N/A INTRINSIC
ZnF_C2H2 711 731 1.24e2 SMART
ZnF_C2H2 740 762 2.82e0 SMART
ZnF_C2H2 768 792 4.99e1 SMART
ZnF_C2H2 799 822 1.73e0 SMART
ZnF_C2H2 827 850 7.89e0 SMART
ZnF_C2H2 892 915 3.89e-3 SMART
low complexity region 924 935 N/A INTRINSIC
low complexity region 965 979 N/A INTRINSIC
ZnF_C2H2 983 1006 4.11e-2 SMART
ZnF_C2H2 1013 1036 7.37e-4 SMART
ZnF_C2H2 1043 1069 7.68e0 SMART
ZnF_C2H2 1124 1146 1.51e0 SMART
ZnF_C2H2 1153 1176 1.23e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125137
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149508
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.5%
Validation Efficiency 97% (113/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play a role in a complex developmental pathway and the regulation of genes involved in cerebellar development. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110035E14Rik T C 1: 9,601,627 F15S probably damaging Het
4930432E11Rik T G 7: 29,574,089 noncoding transcript Het
4930435E12Rik A G 16: 38,828,088 Y220H possibly damaging Het
4931440F15Rik A G 11: 29,824,039 S473P probably benign Het
A2m T C 6: 121,644,936 S314P probably benign Het
Abcc9 T A 6: 142,697,682 I47F probably damaging Het
Abcd2 C T 15: 91,191,481 R43H probably benign Het
Adgre5 A G 8: 83,729,109 V190A probably damaging Het
Aen C T 7: 78,906,029 H242Y possibly damaging Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgap10 T C 8: 77,259,079 I698V probably benign Het
Arpp21 C T 9: 112,119,178 probably benign Het
Atp10a T C 7: 58,827,935 I1294T possibly damaging Het
Atp13a2 T C 4: 140,996,371 Y337H possibly damaging Het
BC147527 T C 13: 120,308,222 L26P probably damaging Het
Bsn C T 9: 108,107,573 G3094D unknown Het
Cadm2 G A 16: 66,747,384 probably benign Het
Cadps T C 14: 12,546,372 M495V probably damaging Het
Cass4 A G 2: 172,427,339 H447R possibly damaging Het
Ccdc124 C A 8: 70,868,944 R108L probably benign Het
Ccdc141 C T 2: 77,014,703 R1340Q probably benign Het
Ccdc148 T G 2: 58,982,899 R299S probably damaging Het
Ccdc36 T A 9: 108,412,985 H140L probably benign Het
Cd300lg A G 11: 102,054,110 E382G probably damaging Het
Cd36 A T 5: 17,797,036 C322* probably null Het
Celsr2 C T 3: 108,398,650 G2046D probably benign Het
Clasrp C T 7: 19,585,263 W492* probably null Het
Cmtr1 T C 17: 29,679,009 V154A possibly damaging Het
Ctnnb1 C T 9: 120,951,034 P128S possibly damaging Het
Cyp11a1 A G 9: 58,026,757 I496V probably damaging Het
Disp2 G A 2: 118,791,927 V1047I probably benign Het
Eps8l2 T C 7: 141,361,724 V636A probably damaging Het
Fars2 T C 13: 36,204,546 L6P probably damaging Het
Fnip1 C T 11: 54,480,684 T177I probably damaging Het
Fut8 G T 12: 77,332,218 R31L probably benign Het
G6pd2 T C 5: 61,810,321 F480L probably benign Het
Glipr1l2 T A 10: 112,092,645 C148* probably null Het
Gm10142 G A 10: 77,715,987 V61M probably benign Het
Gm12169 A G 11: 46,528,531 D58G possibly damaging Het
Gm5134 T A 10: 75,976,346 M145K possibly damaging Het
Gm853 A T 4: 130,211,393 V328D probably benign Het
Gnpda1 T C 18: 38,333,190 probably null Het
Gpc2 T C 5: 138,278,379 T162A probably benign Het
Gtf2h4 G A 17: 35,670,198 L246F possibly damaging Het
Hal C T 10: 93,496,607 P294S probably damaging Het
Hectd3 C T 4: 117,000,343 A573V possibly damaging Het
Hephl1 T A 9: 15,076,818 I665F probably benign Het
Herc1 T C 9: 66,476,126 probably null Het
Hif1an A G 19: 44,571,112 probably null Het
Il12rb1 T A 8: 70,813,680 M223K probably benign Het
Ilf3 C T 9: 21,393,714 T201M probably damaging Het
Inpp5f T C 7: 128,663,969 probably benign Het
Jcad T C 18: 4,674,292 Y685H probably damaging Het
Kcnj1 C A 9: 32,396,738 Q153K probably benign Het
Kctd18 A C 1: 57,959,220 H73Q probably damaging Het
Klhl36 T A 8: 119,876,724 W573R probably damaging Het
Lepr A G 4: 101,772,836 T583A probably benign Het
Ltbp4 G A 7: 27,337,569 probably benign Het
Mapt A T 11: 104,298,499 E114D probably benign Het
Mib1 T A 18: 10,740,972 probably null Het
Mthfd1 G T 12: 76,314,976 A119S probably damaging Het
Mylk4 A T 13: 32,724,853 D90E probably benign Het
Nceh1 T G 3: 27,183,175 L33R probably damaging Het
Nfat5 T C 8: 107,366,236 I91T probably damaging Het
Nxn A G 11: 76,261,672 probably benign Het
Oasl1 G A 5: 114,923,469 A20T possibly damaging Het
Olfr1262 T C 2: 90,002,574 F56S probably benign Het
Olfr141 C T 2: 86,806,827 M57I probably damaging Het
Olfr1428 A G 19: 12,109,507 V13A probably benign Het
Olfr1447 A G 19: 12,900,851 *310Q probably null Het
Olfr164 A T 16: 19,286,302 M147K probably benign Het
Olfr791 T A 10: 129,527,049 V274D probably damaging Het
Pepd T C 7: 34,971,676 V215A probably benign Het
Pfkl A T 10: 78,001,426 N104K probably damaging Het
Phf24 T C 4: 42,938,165 probably benign Het
Pink1 T C 4: 138,314,020 N530S probably benign Het
Pou3f2 T C 4: 22,487,119 D338G probably damaging Het
Ppp1r13b A G 12: 111,834,810 V480A probably damaging Het
Ptgfrn A T 3: 101,056,307 I663N probably benign Het
Rad54b A C 4: 11,601,693 N416T probably damaging Het
Rasef A G 4: 73,744,114 S200P possibly damaging Het
Rbm33 T A 5: 28,387,917 I605N probably damaging Het
Rps19bp1 T C 15: 80,264,079 T31A probably benign Het
Ryr2 T A 13: 11,556,698 T4885S possibly damaging Het
Serpinb6b A G 13: 32,978,240 I222V probably benign Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Skor2 T C 18: 76,859,356 S258P unknown Het
Slc22a29 C T 19: 8,217,759 probably null Het
Slc8a3 A T 12: 81,314,844 F400L probably damaging Het
Slc9a8 T C 2: 167,424,214 I37T possibly damaging Het
Smchd1 A G 17: 71,407,237 I877T possibly damaging Het
Spag5 A G 11: 78,304,176 N103S probably benign Het
Sptbn1 A T 11: 30,142,414 F450L probably damaging Het
Strn4 T A 7: 16,833,921 Y507N probably damaging Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Syt17 G T 7: 118,433,985 L267I possibly damaging Het
Tdo2 T A 3: 81,958,940 R339W probably damaging Het
Ttn A G 2: 76,741,401 S26383P probably damaging Het
Ttn G T 2: 76,808,524 T13938K probably damaging Het
Tulp2 A G 7: 45,517,941 N188D possibly damaging Het
Ube3c C T 5: 29,587,317 R37C probably damaging Het
Uggt2 G T 14: 119,008,055 probably benign Het
Umodl1 G A 17: 30,984,043 V457M probably damaging Het
Usp17la C T 7: 104,860,746 T186I probably benign Het
Vmn1r226 T C 17: 20,687,580 S25P probably damaging Het
Vmn1r235 T A 17: 21,262,397 I328K possibly damaging Het
Vmn2r50 A T 7: 10,047,683 S378R probably benign Het
Vwa2 C T 19: 56,908,934 T557I probably benign Het
Wdr60 A C 12: 116,232,601 S509A probably damaging Het
Yes1 G T 5: 32,684,735 Q534H probably benign Het
Zbtb25 A T 12: 76,349,301 Y382* probably null Het
Zc3h3 G A 15: 75,777,118 P722S probably damaging Het
Zfp36l2 T C 17: 84,186,736 T158A probably damaging Het
Zfp536 T C 7: 37,480,199 T994A probably damaging Het
Zfp629 C A 7: 127,612,000 K212N probably damaging Het
Zfp930 C A 8: 69,228,705 Q350K probably benign Het
Other mutations in Zfp592
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Zfp592 APN 7 81041548 nonsense probably null
IGL01984:Zfp592 APN 7 81038644 missense probably benign 0.00
IGL02079:Zfp592 APN 7 81039230 missense probably benign 0.20
IGL02096:Zfp592 APN 7 81025048 missense probably damaging 1.00
IGL02125:Zfp592 APN 7 81038184 missense probably benign 0.00
IGL02374:Zfp592 APN 7 81024983 missense probably damaging 1.00
IGL02419:Zfp592 APN 7 81038245 missense probably damaging 1.00
IGL02466:Zfp592 APN 7 81023998 missense probably damaging 1.00
IGL02485:Zfp592 APN 7 81037970 splice site probably benign
IGL02500:Zfp592 APN 7 81041726 missense probably benign
IGL02876:Zfp592 APN 7 81038127 missense probably benign 0.01
IGL02940:Zfp592 APN 7 81024827 missense probably damaging 1.00
R0326:Zfp592 UTSW 7 81024889 missense possibly damaging 0.83
R0634:Zfp592 UTSW 7 81038071 missense probably damaging 1.00
R0684:Zfp592 UTSW 7 81037875 missense probably benign 0.00
R0750:Zfp592 UTSW 7 81024745 missense probably benign
R1346:Zfp592 UTSW 7 81038064 missense possibly damaging 0.54
R1457:Zfp592 UTSW 7 81024479 missense probably damaging 0.99
R1650:Zfp592 UTSW 7 81038100 missense probably benign 0.04
R1804:Zfp592 UTSW 7 81023695 missense probably damaging 1.00
R2114:Zfp592 UTSW 7 81024796 missense probably damaging 1.00
R2144:Zfp592 UTSW 7 81038202 missense probably benign 0.01
R2164:Zfp592 UTSW 7 81041438 missense possibly damaging 0.87
R2246:Zfp592 UTSW 7 81041613 missense possibly damaging 0.91
R3701:Zfp592 UTSW 7 81037411 nonsense probably null
R3809:Zfp592 UTSW 7 81024532 missense probably benign 0.00
R4574:Zfp592 UTSW 7 81023786 missense possibly damaging 0.87
R4866:Zfp592 UTSW 7 81041859 missense probably damaging 1.00
R5023:Zfp592 UTSW 7 81024347 missense probably damaging 1.00
R5121:Zfp592 UTSW 7 81023561 missense probably damaging 1.00
R5174:Zfp592 UTSW 7 81038325 missense probably damaging 1.00
R5794:Zfp592 UTSW 7 81025033 missense probably benign 0.00
R5946:Zfp592 UTSW 7 81037897 missense possibly damaging 0.95
R6312:Zfp592 UTSW 7 81023436 missense probably benign 0.05
R6657:Zfp592 UTSW 7 81025486 missense possibly damaging 0.49
R6814:Zfp592 UTSW 7 81023828 missense probably benign 0.02
R6872:Zfp592 UTSW 7 81023828 missense probably benign 0.02
R7056:Zfp592 UTSW 7 81023319 missense probably damaging 1.00
R7295:Zfp592 UTSW 7 81024322 missense probably damaging 1.00
R7351:Zfp592 UTSW 7 81041691 missense probably benign 0.00
R7475:Zfp592 UTSW 7 81023452 missense probably damaging 0.99
R7509:Zfp592 UTSW 7 81038340 missense probably damaging 0.99
R7552:Zfp592 UTSW 7 81023642 missense probably benign 0.01
X0022:Zfp592 UTSW 7 81038187 nonsense probably null
X0028:Zfp592 UTSW 7 81024014 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAACCTATAGGCTGGAATGAG -3'
(R):5'- ATGTCCTCAGGAGACTCCAC -3'

Sequencing Primer
(F):5'- CCTATAGGCTGGAATGAGGGAGAAG -3'
(R):5'- GGAGACTCCACACATCTCTCCATAG -3'
Posted On2014-07-14