Incidental Mutation 'R1918:Zfp592'
ID 212714
Institutional Source Beutler Lab
Gene Symbol Zfp592
Ensembl Gene ENSMUSG00000005621
Gene Name zinc finger protein 592
Synonyms A730014M16Rik
MMRRC Submission 039936-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.926) question?
Stock # R1918 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 80643432-80694912 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 80687168 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 824 (Q824*)
Ref Sequence ENSEMBL: ENSMUSP00000102976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107353]
AlphaFold Q8BHZ4
Predicted Effect probably null
Transcript: ENSMUST00000107353
AA Change: Q824*
SMART Domains Protein: ENSMUSP00000102976
Gene: ENSMUSG00000005621
AA Change: Q824*

DomainStartEndE-ValueType
low complexity region 170 180 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 314 333 N/A INTRINSIC
low complexity region 343 369 N/A INTRINSIC
low complexity region 484 500 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
ZnF_C2H2 587 612 8.98e0 SMART
ZnF_C2H2 615 639 2.61e1 SMART
low complexity region 664 686 N/A INTRINSIC
ZnF_C2H2 711 731 1.24e2 SMART
ZnF_C2H2 740 762 2.82e0 SMART
ZnF_C2H2 768 792 4.99e1 SMART
ZnF_C2H2 799 822 1.73e0 SMART
ZnF_C2H2 827 850 7.89e0 SMART
ZnF_C2H2 892 915 3.89e-3 SMART
low complexity region 924 935 N/A INTRINSIC
low complexity region 965 979 N/A INTRINSIC
ZnF_C2H2 983 1006 4.11e-2 SMART
ZnF_C2H2 1013 1036 7.37e-4 SMART
ZnF_C2H2 1043 1069 7.68e0 SMART
ZnF_C2H2 1124 1146 1.51e0 SMART
ZnF_C2H2 1153 1176 1.23e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125137
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149508
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.5%
Validation Efficiency 97% (113/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play a role in a complex developmental pathway and the regulation of genes involved in cerebellar development. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T G 7: 29,273,514 (GRCm39) noncoding transcript Het
A2m T C 6: 121,621,895 (GRCm39) S314P probably benign Het
Abcc9 T A 6: 142,643,408 (GRCm39) I47F probably damaging Het
Abcd2 C T 15: 91,075,684 (GRCm39) R43H probably benign Het
Adgre5 A G 8: 84,455,738 (GRCm39) V190A probably damaging Het
Aen C T 7: 78,555,777 (GRCm39) H242Y possibly damaging Het
Arfgef1 C T 1: 10,270,103 (GRCm39) A349T probably benign Het
Arhgap10 T C 8: 77,985,708 (GRCm39) I698V probably benign Het
Arpp21 C T 9: 111,948,246 (GRCm39) probably benign Het
Atp10a T C 7: 58,477,683 (GRCm39) I1294T possibly damaging Het
Atp13a2 T C 4: 140,723,682 (GRCm39) Y337H possibly damaging Het
Bsn C T 9: 107,984,772 (GRCm39) G3094D unknown Het
Cadm2 G A 16: 66,544,270 (GRCm39) probably benign Het
Cadps T C 14: 12,546,372 (GRCm38) M495V probably damaging Het
Cass4 A G 2: 172,269,259 (GRCm39) H447R possibly damaging Het
Ccdc124 C A 8: 71,321,588 (GRCm39) R108L probably benign Het
Ccdc141 C T 2: 76,845,047 (GRCm39) R1340Q probably benign Het
Ccdc148 T G 2: 58,872,911 (GRCm39) R299S probably damaging Het
Cd300lg A G 11: 101,944,936 (GRCm39) E382G probably damaging Het
Cd36 A T 5: 18,002,034 (GRCm39) C322* probably null Het
Celsr2 C T 3: 108,305,966 (GRCm39) G2046D probably benign Het
Clasrp C T 7: 19,319,188 (GRCm39) W492* probably null Het
Cmtr1 T C 17: 29,897,983 (GRCm39) V154A possibly damaging Het
Ctnnb1 C T 9: 120,780,100 (GRCm39) P128S possibly damaging Het
Cyp11a1 A G 9: 57,934,040 (GRCm39) I496V probably damaging Het
Disp2 G A 2: 118,622,408 (GRCm39) V1047I probably benign Het
Dync2i1 A C 12: 116,196,221 (GRCm39) S509A probably damaging Het
Eps8l2 T C 7: 140,941,637 (GRCm39) V636A probably damaging Het
Fars2 T C 13: 36,388,529 (GRCm39) L6P probably damaging Het
Fem1al A G 11: 29,774,039 (GRCm39) S473P probably benign Het
Fnip1 C T 11: 54,371,510 (GRCm39) T177I probably damaging Het
Fut8 G T 12: 77,378,992 (GRCm39) R31L probably benign Het
G6pd2 T C 5: 61,967,664 (GRCm39) F480L probably benign Het
Glipr1l2 T A 10: 111,928,550 (GRCm39) C148* probably null Het
Gm10142 G A 10: 77,551,821 (GRCm39) V61M probably benign Het
Gm5134 T A 10: 75,812,180 (GRCm39) M145K possibly damaging Het
Gnpda1 T C 18: 38,466,243 (GRCm39) probably null Het
Gpc2 T C 5: 138,276,641 (GRCm39) T162A probably benign Het
Gtf2h4 G A 17: 35,981,090 (GRCm39) L246F possibly damaging Het
Hal C T 10: 93,332,469 (GRCm39) P294S probably damaging Het
Hectd3 C T 4: 116,857,540 (GRCm39) A573V possibly damaging Het
Hephl1 T A 9: 14,988,114 (GRCm39) I665F probably benign Het
Herc1 T C 9: 66,383,408 (GRCm39) probably null Het
Hif1an A G 19: 44,559,551 (GRCm39) probably null Het
Iho1 T A 9: 108,290,184 (GRCm39) H140L probably benign Het
Il12rb1 T A 8: 71,266,324 (GRCm39) M223K probably benign Het
Ilf3 C T 9: 21,305,010 (GRCm39) T201M probably damaging Het
Inpp5f T C 7: 128,265,693 (GRCm39) probably benign Het
Jcad T C 18: 4,674,292 (GRCm39) Y685H probably damaging Het
Kcnj1 C A 9: 32,308,034 (GRCm39) Q153K probably benign Het
Kctd18 A C 1: 57,998,379 (GRCm39) H73Q probably damaging Het
Klhl36 T A 8: 120,603,463 (GRCm39) W573R probably damaging Het
Ldc1 A T 4: 130,105,186 (GRCm39) V328D probably benign Het
Lepr A G 4: 101,630,033 (GRCm39) T583A probably benign Het
Ltbp4 G A 7: 27,036,994 (GRCm39) probably benign Het
Mapt A T 11: 104,189,325 (GRCm39) E114D probably benign Het
Mib1 T A 18: 10,740,972 (GRCm39) probably null Het
Mthfd1 G T 12: 76,361,750 (GRCm39) A119S probably damaging Het
Mylk4 A T 13: 32,908,836 (GRCm39) D90E probably benign Het
Nceh1 T G 3: 27,237,324 (GRCm39) L33R probably damaging Het
Nfat5 T C 8: 108,092,868 (GRCm39) I91T probably damaging Het
Nxn A G 11: 76,152,498 (GRCm39) probably benign Het
Oasl1 G A 5: 115,061,528 (GRCm39) A20T possibly damaging Het
Or2m12 A T 16: 19,105,052 (GRCm39) M147K probably benign Het
Or4c127 T C 2: 89,832,918 (GRCm39) F56S probably benign Het
Or4d6 A G 19: 12,086,871 (GRCm39) V13A probably benign Het
Or5b97 A G 19: 12,878,215 (GRCm39) *310Q probably null Het
Or5t18 C T 2: 86,637,171 (GRCm39) M57I probably damaging Het
Or6c2 T A 10: 129,362,918 (GRCm39) V274D probably damaging Het
Pepd T C 7: 34,671,101 (GRCm39) V215A probably benign Het
Pfkl A T 10: 77,837,260 (GRCm39) N104K probably damaging Het
Phf24 T C 4: 42,938,165 (GRCm39) probably benign Het
Pink1 T C 4: 138,041,331 (GRCm39) N530S probably benign Het
Pou3f2 T C 4: 22,487,119 (GRCm39) D338G probably damaging Het
Ppp1r13b A G 12: 111,801,244 (GRCm39) V480A probably damaging Het
Ptgfrn A T 3: 100,963,623 (GRCm39) I663N probably benign Het
Rad54b A C 4: 11,601,693 (GRCm39) N416T probably damaging Het
Rasef A G 4: 73,662,351 (GRCm39) S200P possibly damaging Het
Rbm33 T A 5: 28,592,915 (GRCm39) I605N probably damaging Het
Rps19bp1 T C 15: 80,148,280 (GRCm39) T31A probably benign Het
Ryr2 T A 13: 11,571,584 (GRCm39) T4885S possibly damaging Het
Serpinb6b A G 13: 33,162,223 (GRCm39) I222V probably benign Het
Sik3 C G 9: 46,132,387 (GRCm39) H1276Q probably benign Het
Skor2 T C 18: 76,947,051 (GRCm39) S258P unknown Het
Slc22a29 C T 19: 8,195,123 (GRCm39) probably null Het
Slc8a3 A T 12: 81,361,618 (GRCm39) F400L probably damaging Het
Slc9a8 T C 2: 167,266,134 (GRCm39) I37T possibly damaging Het
Smchd1 A G 17: 71,714,232 (GRCm39) I877T possibly damaging Het
Spag5 A G 11: 78,195,002 (GRCm39) N103S probably benign Het
Sptbn1 A T 11: 30,092,414 (GRCm39) F450L probably damaging Het
Strn4 T A 7: 16,567,846 (GRCm39) Y507N probably damaging Het
Stxbp5 C A 10: 9,688,042 (GRCm39) V420F possibly damaging Het
Syt17 G T 7: 118,033,208 (GRCm39) L267I possibly damaging Het
Tcstv4 T C 13: 120,769,758 (GRCm39) L26P probably damaging Het
Tdo2 T A 3: 81,866,247 (GRCm39) R339W probably damaging Het
Tex55 A G 16: 38,648,450 (GRCm39) Y220H possibly damaging Het
Timd5 A G 11: 46,419,358 (GRCm39) D58G possibly damaging Het
Ttn A G 2: 76,571,745 (GRCm39) S26383P probably damaging Het
Ttn G T 2: 76,638,868 (GRCm39) T13938K probably damaging Het
Tulp2 A G 7: 45,167,365 (GRCm39) N188D possibly damaging Het
Ube3c C T 5: 29,792,315 (GRCm39) R37C probably damaging Het
Uggt2 G T 14: 119,245,467 (GRCm39) probably benign Het
Umodl1 G A 17: 31,203,017 (GRCm39) V457M probably damaging Het
Usp17la C T 7: 104,509,953 (GRCm39) T186I probably benign Het
Vmn1r226 T C 17: 20,907,842 (GRCm39) S25P probably damaging Het
Vmn1r235 T A 17: 21,482,659 (GRCm39) I328K possibly damaging Het
Vmn2r50 A T 7: 9,781,610 (GRCm39) S378R probably benign Het
Vwa2 C T 19: 56,897,366 (GRCm39) T557I probably benign Het
Vxn T C 1: 9,671,852 (GRCm39) F15S probably damaging Het
Yes1 G T 5: 32,842,079 (GRCm39) Q534H probably benign Het
Zbtb25 A T 12: 76,396,075 (GRCm39) Y382* probably null Het
Zc3h3 G A 15: 75,648,967 (GRCm39) P722S probably damaging Het
Zfp36l2 T C 17: 84,494,164 (GRCm39) T158A probably damaging Het
Zfp536 T C 7: 37,179,624 (GRCm39) T994A probably damaging Het
Zfp629 C A 7: 127,211,172 (GRCm39) K212N probably damaging Het
Zfp930 C A 8: 69,681,357 (GRCm39) Q350K probably benign Het
Other mutations in Zfp592
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Zfp592 APN 7 80,691,296 (GRCm39) nonsense probably null
IGL01984:Zfp592 APN 7 80,688,392 (GRCm39) missense probably benign 0.00
IGL02079:Zfp592 APN 7 80,688,978 (GRCm39) missense probably benign 0.20
IGL02096:Zfp592 APN 7 80,674,796 (GRCm39) missense probably damaging 1.00
IGL02125:Zfp592 APN 7 80,687,932 (GRCm39) missense probably benign 0.00
IGL02374:Zfp592 APN 7 80,674,731 (GRCm39) missense probably damaging 1.00
IGL02419:Zfp592 APN 7 80,687,993 (GRCm39) missense probably damaging 1.00
IGL02466:Zfp592 APN 7 80,673,746 (GRCm39) missense probably damaging 1.00
IGL02485:Zfp592 APN 7 80,687,718 (GRCm39) splice site probably benign
IGL02500:Zfp592 APN 7 80,691,474 (GRCm39) missense probably benign
IGL02876:Zfp592 APN 7 80,687,875 (GRCm39) missense probably benign 0.01
IGL02940:Zfp592 APN 7 80,674,575 (GRCm39) missense probably damaging 1.00
R0326:Zfp592 UTSW 7 80,674,637 (GRCm39) missense possibly damaging 0.83
R0634:Zfp592 UTSW 7 80,687,819 (GRCm39) missense probably damaging 1.00
R0684:Zfp592 UTSW 7 80,687,623 (GRCm39) missense probably benign 0.00
R0750:Zfp592 UTSW 7 80,674,493 (GRCm39) missense probably benign
R1346:Zfp592 UTSW 7 80,687,812 (GRCm39) missense possibly damaging 0.54
R1457:Zfp592 UTSW 7 80,674,227 (GRCm39) missense probably damaging 0.99
R1650:Zfp592 UTSW 7 80,687,848 (GRCm39) missense probably benign 0.04
R1804:Zfp592 UTSW 7 80,673,443 (GRCm39) missense probably damaging 1.00
R2114:Zfp592 UTSW 7 80,674,544 (GRCm39) missense probably damaging 1.00
R2144:Zfp592 UTSW 7 80,687,950 (GRCm39) missense probably benign 0.01
R2164:Zfp592 UTSW 7 80,691,186 (GRCm39) missense possibly damaging 0.87
R2246:Zfp592 UTSW 7 80,691,361 (GRCm39) missense possibly damaging 0.91
R3701:Zfp592 UTSW 7 80,687,159 (GRCm39) nonsense probably null
R3809:Zfp592 UTSW 7 80,674,280 (GRCm39) missense probably benign 0.00
R4574:Zfp592 UTSW 7 80,673,534 (GRCm39) missense possibly damaging 0.87
R4866:Zfp592 UTSW 7 80,691,607 (GRCm39) missense probably damaging 1.00
R5023:Zfp592 UTSW 7 80,674,095 (GRCm39) missense probably damaging 1.00
R5121:Zfp592 UTSW 7 80,673,309 (GRCm39) missense probably damaging 1.00
R5174:Zfp592 UTSW 7 80,688,073 (GRCm39) missense probably damaging 1.00
R5794:Zfp592 UTSW 7 80,674,781 (GRCm39) missense probably benign 0.00
R5946:Zfp592 UTSW 7 80,687,645 (GRCm39) missense possibly damaging 0.95
R6312:Zfp592 UTSW 7 80,673,184 (GRCm39) missense probably benign 0.05
R6657:Zfp592 UTSW 7 80,675,234 (GRCm39) missense possibly damaging 0.49
R6814:Zfp592 UTSW 7 80,673,576 (GRCm39) missense probably benign 0.02
R6872:Zfp592 UTSW 7 80,673,576 (GRCm39) missense probably benign 0.02
R7056:Zfp592 UTSW 7 80,673,067 (GRCm39) missense probably damaging 1.00
R7295:Zfp592 UTSW 7 80,674,070 (GRCm39) missense probably damaging 1.00
R7351:Zfp592 UTSW 7 80,691,439 (GRCm39) missense probably benign 0.00
R7475:Zfp592 UTSW 7 80,673,200 (GRCm39) missense probably damaging 0.99
R7509:Zfp592 UTSW 7 80,688,088 (GRCm39) missense probably damaging 0.99
R7552:Zfp592 UTSW 7 80,673,390 (GRCm39) missense probably benign 0.01
R7737:Zfp592 UTSW 7 80,674,941 (GRCm39) missense probably damaging 1.00
R7752:Zfp592 UTSW 7 80,674,469 (GRCm39) missense probably benign 0.13
R7901:Zfp592 UTSW 7 80,674,469 (GRCm39) missense probably benign 0.13
R8100:Zfp592 UTSW 7 80,673,940 (GRCm39) missense probably benign 0.05
R8440:Zfp592 UTSW 7 80,691,271 (GRCm39) missense possibly damaging 0.89
R8710:Zfp592 UTSW 7 80,673,321 (GRCm39) missense probably damaging 1.00
R8766:Zfp592 UTSW 7 80,674,353 (GRCm39) missense probably benign 0.00
R9083:Zfp592 UTSW 7 80,674,644 (GRCm39) missense possibly damaging 0.95
R9141:Zfp592 UTSW 7 80,674,205 (GRCm39) missense probably damaging 1.00
R9194:Zfp592 UTSW 7 80,674,349 (GRCm39) missense probably benign
R9197:Zfp592 UTSW 7 80,674,067 (GRCm39) missense possibly damaging 0.73
R9246:Zfp592 UTSW 7 80,691,529 (GRCm39) missense probably benign 0.03
R9321:Zfp592 UTSW 7 80,691,226 (GRCm39) missense possibly damaging 0.65
R9426:Zfp592 UTSW 7 80,674,205 (GRCm39) missense probably damaging 1.00
R9785:Zfp592 UTSW 7 80,673,245 (GRCm39) missense probably damaging 1.00
X0022:Zfp592 UTSW 7 80,687,935 (GRCm39) nonsense probably null
X0028:Zfp592 UTSW 7 80,673,762 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAACCTATAGGCTGGAATGAG -3'
(R):5'- ATGTCCTCAGGAGACTCCAC -3'

Sequencing Primer
(F):5'- CCTATAGGCTGGAATGAGGGAGAAG -3'
(R):5'- GGAGACTCCACACATCTCTCCATAG -3'
Posted On 2014-07-14