Incidental Mutation 'R1918:Kcnj1'
ID 212730
Institutional Source Beutler Lab
Gene Symbol Kcnj1
Ensembl Gene ENSMUSG00000041248
Gene Name potassium inwardly-rectifying channel, subfamily J, member 1
Synonyms ROMK-2, Kir1.1, ROMK
MMRRC Submission 039936-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R1918 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 32283789-32310493 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 32308034 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 153 (Q153K)
Ref Sequence ENSEMBL: ENSMUSP00000131625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047334] [ENSMUST00000172015] [ENSMUST00000213393]
AlphaFold O88335
Predicted Effect probably benign
Transcript: ENSMUST00000047334
AA Change: Q133K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046793
Gene: ENSMUSG00000041248
AA Change: Q133K

DomainStartEndE-ValueType
Pfam:IRK 24 361 1.4e-155 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172015
AA Change: Q153K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131625
Gene: ENSMUSG00000041248
AA Change: Q153K

DomainStartEndE-ValueType
Pfam:IRK 44 373 7.6e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213393
AA Change: Q133K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0594 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.5%
Validation Efficiency 97% (113/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. It is activated by internal ATP and probably plays an important role in potassium homeostasis. The encoded protein has a greater tendency to allow potassium to flow into a cell rather than out of a cell. Mutations in this gene have been associated with antenatal Bartter syndrome, which is characterized by salt wasting, hypokalemic alkalosis, hypercalciuria, and low blood pressure. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygotes for a null mutation die before weaning with impaired electrolyte, acid-base, and fluid-volume homeostasis, reduced NaCl absorption in the thick ascending limb, and abnormal tubuloglomerular feedback. A colony of mutants with extended suvival serves as a model for Bartter's syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T G 7: 29,273,514 (GRCm39) noncoding transcript Het
A2m T C 6: 121,621,895 (GRCm39) S314P probably benign Het
Abcc9 T A 6: 142,643,408 (GRCm39) I47F probably damaging Het
Abcd2 C T 15: 91,075,684 (GRCm39) R43H probably benign Het
Adgre5 A G 8: 84,455,738 (GRCm39) V190A probably damaging Het
Aen C T 7: 78,555,777 (GRCm39) H242Y possibly damaging Het
Arfgef1 C T 1: 10,270,103 (GRCm39) A349T probably benign Het
Arhgap10 T C 8: 77,985,708 (GRCm39) I698V probably benign Het
Arpp21 C T 9: 111,948,246 (GRCm39) probably benign Het
Atp10a T C 7: 58,477,683 (GRCm39) I1294T possibly damaging Het
Atp13a2 T C 4: 140,723,682 (GRCm39) Y337H possibly damaging Het
Bsn C T 9: 107,984,772 (GRCm39) G3094D unknown Het
Cadm2 G A 16: 66,544,270 (GRCm39) probably benign Het
Cadps T C 14: 12,546,372 (GRCm38) M495V probably damaging Het
Cass4 A G 2: 172,269,259 (GRCm39) H447R possibly damaging Het
Ccdc124 C A 8: 71,321,588 (GRCm39) R108L probably benign Het
Ccdc141 C T 2: 76,845,047 (GRCm39) R1340Q probably benign Het
Ccdc148 T G 2: 58,872,911 (GRCm39) R299S probably damaging Het
Cd300lg A G 11: 101,944,936 (GRCm39) E382G probably damaging Het
Cd36 A T 5: 18,002,034 (GRCm39) C322* probably null Het
Celsr2 C T 3: 108,305,966 (GRCm39) G2046D probably benign Het
Clasrp C T 7: 19,319,188 (GRCm39) W492* probably null Het
Cmtr1 T C 17: 29,897,983 (GRCm39) V154A possibly damaging Het
Ctnnb1 C T 9: 120,780,100 (GRCm39) P128S possibly damaging Het
Cyp11a1 A G 9: 57,934,040 (GRCm39) I496V probably damaging Het
Disp2 G A 2: 118,622,408 (GRCm39) V1047I probably benign Het
Dync2i1 A C 12: 116,196,221 (GRCm39) S509A probably damaging Het
Eps8l2 T C 7: 140,941,637 (GRCm39) V636A probably damaging Het
Fars2 T C 13: 36,388,529 (GRCm39) L6P probably damaging Het
Fem1al A G 11: 29,774,039 (GRCm39) S473P probably benign Het
Fnip1 C T 11: 54,371,510 (GRCm39) T177I probably damaging Het
Fut8 G T 12: 77,378,992 (GRCm39) R31L probably benign Het
G6pd2 T C 5: 61,967,664 (GRCm39) F480L probably benign Het
Glipr1l2 T A 10: 111,928,550 (GRCm39) C148* probably null Het
Gm10142 G A 10: 77,551,821 (GRCm39) V61M probably benign Het
Gm5134 T A 10: 75,812,180 (GRCm39) M145K possibly damaging Het
Gnpda1 T C 18: 38,466,243 (GRCm39) probably null Het
Gpc2 T C 5: 138,276,641 (GRCm39) T162A probably benign Het
Gtf2h4 G A 17: 35,981,090 (GRCm39) L246F possibly damaging Het
Hal C T 10: 93,332,469 (GRCm39) P294S probably damaging Het
Hectd3 C T 4: 116,857,540 (GRCm39) A573V possibly damaging Het
Hephl1 T A 9: 14,988,114 (GRCm39) I665F probably benign Het
Herc1 T C 9: 66,383,408 (GRCm39) probably null Het
Hif1an A G 19: 44,559,551 (GRCm39) probably null Het
Iho1 T A 9: 108,290,184 (GRCm39) H140L probably benign Het
Il12rb1 T A 8: 71,266,324 (GRCm39) M223K probably benign Het
Ilf3 C T 9: 21,305,010 (GRCm39) T201M probably damaging Het
Inpp5f T C 7: 128,265,693 (GRCm39) probably benign Het
Jcad T C 18: 4,674,292 (GRCm39) Y685H probably damaging Het
Kctd18 A C 1: 57,998,379 (GRCm39) H73Q probably damaging Het
Klhl36 T A 8: 120,603,463 (GRCm39) W573R probably damaging Het
Ldc1 A T 4: 130,105,186 (GRCm39) V328D probably benign Het
Lepr A G 4: 101,630,033 (GRCm39) T583A probably benign Het
Ltbp4 G A 7: 27,036,994 (GRCm39) probably benign Het
Mapt A T 11: 104,189,325 (GRCm39) E114D probably benign Het
Mib1 T A 18: 10,740,972 (GRCm39) probably null Het
Mthfd1 G T 12: 76,361,750 (GRCm39) A119S probably damaging Het
Mylk4 A T 13: 32,908,836 (GRCm39) D90E probably benign Het
Nceh1 T G 3: 27,237,324 (GRCm39) L33R probably damaging Het
Nfat5 T C 8: 108,092,868 (GRCm39) I91T probably damaging Het
Nxn A G 11: 76,152,498 (GRCm39) probably benign Het
Oasl1 G A 5: 115,061,528 (GRCm39) A20T possibly damaging Het
Or2m12 A T 16: 19,105,052 (GRCm39) M147K probably benign Het
Or4c127 T C 2: 89,832,918 (GRCm39) F56S probably benign Het
Or4d6 A G 19: 12,086,871 (GRCm39) V13A probably benign Het
Or5b97 A G 19: 12,878,215 (GRCm39) *310Q probably null Het
Or5t18 C T 2: 86,637,171 (GRCm39) M57I probably damaging Het
Or6c2 T A 10: 129,362,918 (GRCm39) V274D probably damaging Het
Pepd T C 7: 34,671,101 (GRCm39) V215A probably benign Het
Pfkl A T 10: 77,837,260 (GRCm39) N104K probably damaging Het
Phf24 T C 4: 42,938,165 (GRCm39) probably benign Het
Pink1 T C 4: 138,041,331 (GRCm39) N530S probably benign Het
Pou3f2 T C 4: 22,487,119 (GRCm39) D338G probably damaging Het
Ppp1r13b A G 12: 111,801,244 (GRCm39) V480A probably damaging Het
Ptgfrn A T 3: 100,963,623 (GRCm39) I663N probably benign Het
Rad54b A C 4: 11,601,693 (GRCm39) N416T probably damaging Het
Rasef A G 4: 73,662,351 (GRCm39) S200P possibly damaging Het
Rbm33 T A 5: 28,592,915 (GRCm39) I605N probably damaging Het
Rps19bp1 T C 15: 80,148,280 (GRCm39) T31A probably benign Het
Ryr2 T A 13: 11,571,584 (GRCm39) T4885S possibly damaging Het
Serpinb6b A G 13: 33,162,223 (GRCm39) I222V probably benign Het
Sik3 C G 9: 46,132,387 (GRCm39) H1276Q probably benign Het
Skor2 T C 18: 76,947,051 (GRCm39) S258P unknown Het
Slc22a29 C T 19: 8,195,123 (GRCm39) probably null Het
Slc8a3 A T 12: 81,361,618 (GRCm39) F400L probably damaging Het
Slc9a8 T C 2: 167,266,134 (GRCm39) I37T possibly damaging Het
Smchd1 A G 17: 71,714,232 (GRCm39) I877T possibly damaging Het
Spag5 A G 11: 78,195,002 (GRCm39) N103S probably benign Het
Sptbn1 A T 11: 30,092,414 (GRCm39) F450L probably damaging Het
Strn4 T A 7: 16,567,846 (GRCm39) Y507N probably damaging Het
Stxbp5 C A 10: 9,688,042 (GRCm39) V420F possibly damaging Het
Syt17 G T 7: 118,033,208 (GRCm39) L267I possibly damaging Het
Tcstv4 T C 13: 120,769,758 (GRCm39) L26P probably damaging Het
Tdo2 T A 3: 81,866,247 (GRCm39) R339W probably damaging Het
Tex55 A G 16: 38,648,450 (GRCm39) Y220H possibly damaging Het
Timd5 A G 11: 46,419,358 (GRCm39) D58G possibly damaging Het
Ttn A G 2: 76,571,745 (GRCm39) S26383P probably damaging Het
Ttn G T 2: 76,638,868 (GRCm39) T13938K probably damaging Het
Tulp2 A G 7: 45,167,365 (GRCm39) N188D possibly damaging Het
Ube3c C T 5: 29,792,315 (GRCm39) R37C probably damaging Het
Uggt2 G T 14: 119,245,467 (GRCm39) probably benign Het
Umodl1 G A 17: 31,203,017 (GRCm39) V457M probably damaging Het
Usp17la C T 7: 104,509,953 (GRCm39) T186I probably benign Het
Vmn1r226 T C 17: 20,907,842 (GRCm39) S25P probably damaging Het
Vmn1r235 T A 17: 21,482,659 (GRCm39) I328K possibly damaging Het
Vmn2r50 A T 7: 9,781,610 (GRCm39) S378R probably benign Het
Vwa2 C T 19: 56,897,366 (GRCm39) T557I probably benign Het
Vxn T C 1: 9,671,852 (GRCm39) F15S probably damaging Het
Yes1 G T 5: 32,842,079 (GRCm39) Q534H probably benign Het
Zbtb25 A T 12: 76,396,075 (GRCm39) Y382* probably null Het
Zc3h3 G A 15: 75,648,967 (GRCm39) P722S probably damaging Het
Zfp36l2 T C 17: 84,494,164 (GRCm39) T158A probably damaging Het
Zfp536 T C 7: 37,179,624 (GRCm39) T994A probably damaging Het
Zfp592 C T 7: 80,687,168 (GRCm39) Q824* probably null Het
Zfp629 C A 7: 127,211,172 (GRCm39) K212N probably damaging Het
Zfp930 C A 8: 69,681,357 (GRCm39) Q350K probably benign Het
Other mutations in Kcnj1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Kcnj1 APN 9 32,307,794 (GRCm39) missense probably benign 0.01
IGL02958:Kcnj1 APN 9 32,307,851 (GRCm39) missense probably damaging 1.00
IGL03285:Kcnj1 APN 9 32,308,157 (GRCm39) missense possibly damaging 0.67
R1179:Kcnj1 UTSW 9 32,308,062 (GRCm39) missense probably damaging 0.96
R1503:Kcnj1 UTSW 9 32,307,788 (GRCm39) missense probably damaging 0.98
R4439:Kcnj1 UTSW 9 32,305,414 (GRCm39) intron probably benign
R4659:Kcnj1 UTSW 9 32,305,444 (GRCm39) missense probably benign
R4661:Kcnj1 UTSW 9 32,307,918 (GRCm39) missense probably benign 0.14
R4917:Kcnj1 UTSW 9 32,308,056 (GRCm39) missense probably damaging 0.99
R4918:Kcnj1 UTSW 9 32,308,056 (GRCm39) missense probably damaging 0.99
R5385:Kcnj1 UTSW 9 32,308,019 (GRCm39) missense probably damaging 1.00
R6017:Kcnj1 UTSW 9 32,305,400 (GRCm39) intron probably benign
R6036:Kcnj1 UTSW 9 32,308,421 (GRCm39) missense probably benign 0.15
R6036:Kcnj1 UTSW 9 32,308,421 (GRCm39) missense probably benign 0.15
R6117:Kcnj1 UTSW 9 32,308,478 (GRCm39) missense probably damaging 1.00
R6245:Kcnj1 UTSW 9 32,308,163 (GRCm39) missense probably damaging 1.00
R6316:Kcnj1 UTSW 9 32,308,632 (GRCm39) missense probably damaging 0.96
R6585:Kcnj1 UTSW 9 32,308,557 (GRCm39) missense probably benign
R6988:Kcnj1 UTSW 9 32,307,881 (GRCm39) missense probably benign 0.17
R7116:Kcnj1 UTSW 9 32,308,277 (GRCm39) missense possibly damaging 0.91
R7393:Kcnj1 UTSW 9 32,308,314 (GRCm39) missense probably damaging 1.00
R7870:Kcnj1 UTSW 9 32,307,881 (GRCm39) missense probably benign 0.17
R8072:Kcnj1 UTSW 9 32,308,593 (GRCm39) missense probably damaging 1.00
R8391:Kcnj1 UTSW 9 32,308,028 (GRCm39) missense probably damaging 1.00
R9264:Kcnj1 UTSW 9 32,307,654 (GRCm39) missense probably benign 0.03
R9418:Kcnj1 UTSW 9 32,308,203 (GRCm39) missense probably damaging 1.00
Z1177:Kcnj1 UTSW 9 32,308,655 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCCTTCTTGGGGAGTTG -3'
(R):5'- GCTTTTCCTAAGATTTGCTACTCGG -3'

Sequencing Primer
(F):5'- AGTTGGTTTCTCTTTGGTCTCC -3'
(R):5'- GATGAGGAGACAGAGCTTCCCC -3'
Posted On 2014-07-14