Incidental Mutation 'R1918:Ctnnb1'
ID212738
Institutional Source Beutler Lab
Gene Symbol Ctnnb1
Ensembl Gene ENSMUSG00000006932
Gene Namecatenin (cadherin associated protein), beta 1
Synonymsbeta-catenin, Catnb, beta catenin
MMRRC Submission 039936-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1918 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location120929216-120960507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120951034 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 128 (P128S)
Ref Sequence ENSEMBL: ENSMUSP00000136294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007130] [ENSMUST00000130466] [ENSMUST00000130845] [ENSMUST00000145093] [ENSMUST00000154356] [ENSMUST00000163844] [ENSMUST00000178812]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007130
AA Change: P128S

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000007130
Gene: ENSMUSG00000006932
AA Change: P128S

DomainStartEndE-ValueType
ARM 141 180 1.92e1 SMART
ARM 181 223 6.29e-2 SMART
ARM 224 264 1.23e-4 SMART
ARM 265 306 7.34e-3 SMART
ARM 308 349 2.48e0 SMART
ARM 350 390 1.48e-7 SMART
ARM 392 429 3.18e1 SMART
ARM 430 473 1.54e-5 SMART
ARM 478 519 7.34e-3 SMART
ARM 520 582 3.34e-6 SMART
ARM 583 623 2.82e-4 SMART
ARM 624 664 1.78e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126633
Predicted Effect probably benign
Transcript: ENSMUST00000130466
Predicted Effect probably benign
Transcript: ENSMUST00000130845
SMART Domains Protein: ENSMUSP00000116365
Gene: ENSMUSG00000006932

DomainStartEndE-ValueType
PDB:2Z6G|A 1 80 2e-43 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000133689
SMART Domains Protein: ENSMUSP00000128564
Gene: ENSMUSG00000006932

DomainStartEndE-ValueType
Blast:ARM 2 41 2e-20 BLAST
Pfam:Arm 42 82 4.4e-9 PFAM
Blast:ARM 83 123 9e-10 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000145093
AA Change: P128S

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120132
Gene: ENSMUSG00000006932
AA Change: P128S

DomainStartEndE-ValueType
PDB:2Z6G|A 1 174 1e-113 PDB
SCOP:d1gw5a_ 90 172 5e-8 SMART
Blast:ARM 141 174 4e-15 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000154356
AA Change: P128S

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125763
Gene: ENSMUSG00000006932
AA Change: P128S

DomainStartEndE-ValueType
ARM 141 180 1.92e1 SMART
ARM 181 223 6.29e-2 SMART
ARM 224 264 1.23e-4 SMART
ARM 265 306 7.34e-3 SMART
ARM 308 349 2.48e0 SMART
ARM 350 390 1.48e-7 SMART
ARM 392 429 3.18e1 SMART
ARM 430 473 1.54e-5 SMART
ARM 478 519 7.34e-3 SMART
ARM 520 562 3e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156911
Predicted Effect silent
Transcript: ENSMUST00000163844
SMART Domains Protein: ENSMUSP00000126905
Gene: ENSMUSG00000006932

DomainStartEndE-ValueType
PDB:2Z6G|A 1 72 2e-37 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000169931
SMART Domains Protein: ENSMUSP00000128858
Gene: ENSMUSG00000006932

DomainStartEndE-ValueType
ARM 2 36 3.8e1 SMART
ARM 41 82 7.34e-3 SMART
ARM 83 144 1.92e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170729
SMART Domains Protein: ENSMUSP00000130471
Gene: ENSMUSG00000006932

DomainStartEndE-ValueType
Blast:ARM 2 35 4e-15 BLAST
PDB:3SLA|E 2 87 1e-57 PDB
SCOP:d1jdha_ 2 89 2e-12 SMART
Blast:ARM 36 78 2e-23 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000178812
AA Change: P128S

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136294
Gene: ENSMUSG00000006932
AA Change: P128S

DomainStartEndE-ValueType
ARM 141 180 1.92e1 SMART
ARM 181 223 6.29e-2 SMART
ARM 224 264 1.23e-4 SMART
ARM 265 306 7.34e-3 SMART
ARM 308 349 2.48e0 SMART
ARM 350 390 1.48e-7 SMART
ARM 392 429 3.18e1 SMART
ARM 430 473 1.54e-5 SMART
ARM 478 519 7.34e-3 SMART
ARM 520 582 3.34e-6 SMART
ARM 583 623 2.82e-4 SMART
ARM 624 664 1.78e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213408
Meta Mutation Damage Score 0.2403 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.5%
Validation Efficiency 97% (113/116)
MGI Phenotype FUNCTION: This gene encodes not only an important cytoplasmic component of the classical cadherin adhesion complex that forms the adherens junction in epithelia and mediates cell-cell adhesion in many other tissues but also a key signaling molecule in the canonical Wnt signaling pathway that controls cell growth and differentiation during both normal development and tumorigenesis. The gene product contains a central armadillo-repeat containing domain through which it binds the cytoplasmic tail of classical cadherins; meanwhile, it also binds alpha-catenin, which further links the cadherin complex to the actin cytoskeleton either directly or indirectly. Beta-catenin is therefore necessary for the adhesive function of classical cadherins. Another key function of this protein is to mediate the canonical Wnt signaling pathway and regulate gene transcription. Without Wnt signal, cytoplasmic beta-catenin that is not associated with the cadherin complex is quickly phosphorylated at the N-terminal Ser/Thr residues by the so called degradation complex containing axin, adenomatous polyposis coli (APC), casein kinase I, and GSK3B, then ubiquitylated by beta-TrCP, and degraded by the proteasome. However, in the presence of Wnt signal, the degradation complex is disrupted and the stabilized cytoplasmic beta-catenin translocates into the nucleus, where it binds various transcription factors and, together with these factors, regulates the transcription of many downstream genes. Mutations of this gene have been linked with various types of tumors. Alternatively spliced variants have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null embryos show anterior-posterior axis formation anomalies, but develop to E7. Multiple conditional mutations have shown defects in distinct stem cell types that result in proliferation defects, such as intestinal polyps, brain and spinal cord size anomalies, etc. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110035E14Rik T C 1: 9,601,627 F15S probably damaging Het
4930432E11Rik T G 7: 29,574,089 noncoding transcript Het
4930435E12Rik A G 16: 38,828,088 Y220H possibly damaging Het
4931440F15Rik A G 11: 29,824,039 S473P probably benign Het
A2m T C 6: 121,644,936 S314P probably benign Het
Abcc9 T A 6: 142,697,682 I47F probably damaging Het
Abcd2 C T 15: 91,191,481 R43H probably benign Het
Adgre5 A G 8: 83,729,109 V190A probably damaging Het
Aen C T 7: 78,906,029 H242Y possibly damaging Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgap10 T C 8: 77,259,079 I698V probably benign Het
Arpp21 C T 9: 112,119,178 probably benign Het
Atp10a T C 7: 58,827,935 I1294T possibly damaging Het
Atp13a2 T C 4: 140,996,371 Y337H possibly damaging Het
BC147527 T C 13: 120,308,222 L26P probably damaging Het
Bsn C T 9: 108,107,573 G3094D unknown Het
Cadm2 G A 16: 66,747,384 probably benign Het
Cadps T C 14: 12,546,372 M495V probably damaging Het
Cass4 A G 2: 172,427,339 H447R possibly damaging Het
Ccdc124 C A 8: 70,868,944 R108L probably benign Het
Ccdc141 C T 2: 77,014,703 R1340Q probably benign Het
Ccdc148 T G 2: 58,982,899 R299S probably damaging Het
Ccdc36 T A 9: 108,412,985 H140L probably benign Het
Cd300lg A G 11: 102,054,110 E382G probably damaging Het
Cd36 A T 5: 17,797,036 C322* probably null Het
Celsr2 C T 3: 108,398,650 G2046D probably benign Het
Clasrp C T 7: 19,585,263 W492* probably null Het
Cmtr1 T C 17: 29,679,009 V154A possibly damaging Het
Cyp11a1 A G 9: 58,026,757 I496V probably damaging Het
Disp2 G A 2: 118,791,927 V1047I probably benign Het
Eps8l2 T C 7: 141,361,724 V636A probably damaging Het
Fars2 T C 13: 36,204,546 L6P probably damaging Het
Fnip1 C T 11: 54,480,684 T177I probably damaging Het
Fut8 G T 12: 77,332,218 R31L probably benign Het
G6pd2 T C 5: 61,810,321 F480L probably benign Het
Glipr1l2 T A 10: 112,092,645 C148* probably null Het
Gm10142 G A 10: 77,715,987 V61M probably benign Het
Gm12169 A G 11: 46,528,531 D58G possibly damaging Het
Gm5134 T A 10: 75,976,346 M145K possibly damaging Het
Gm853 A T 4: 130,211,393 V328D probably benign Het
Gnpda1 T C 18: 38,333,190 probably null Het
Gpc2 T C 5: 138,278,379 T162A probably benign Het
Gtf2h4 G A 17: 35,670,198 L246F possibly damaging Het
Hal C T 10: 93,496,607 P294S probably damaging Het
Hectd3 C T 4: 117,000,343 A573V possibly damaging Het
Hephl1 T A 9: 15,076,818 I665F probably benign Het
Herc1 T C 9: 66,476,126 probably null Het
Hif1an A G 19: 44,571,112 probably null Het
Il12rb1 T A 8: 70,813,680 M223K probably benign Het
Ilf3 C T 9: 21,393,714 T201M probably damaging Het
Inpp5f T C 7: 128,663,969 probably benign Het
Jcad T C 18: 4,674,292 Y685H probably damaging Het
Kcnj1 C A 9: 32,396,738 Q153K probably benign Het
Kctd18 A C 1: 57,959,220 H73Q probably damaging Het
Klhl36 T A 8: 119,876,724 W573R probably damaging Het
Lepr A G 4: 101,772,836 T583A probably benign Het
Ltbp4 G A 7: 27,337,569 probably benign Het
Mapt A T 11: 104,298,499 E114D probably benign Het
Mib1 T A 18: 10,740,972 probably null Het
Mthfd1 G T 12: 76,314,976 A119S probably damaging Het
Mylk4 A T 13: 32,724,853 D90E probably benign Het
Nceh1 T G 3: 27,183,175 L33R probably damaging Het
Nfat5 T C 8: 107,366,236 I91T probably damaging Het
Nxn A G 11: 76,261,672 probably benign Het
Oasl1 G A 5: 114,923,469 A20T possibly damaging Het
Olfr1262 T C 2: 90,002,574 F56S probably benign Het
Olfr141 C T 2: 86,806,827 M57I probably damaging Het
Olfr1428 A G 19: 12,109,507 V13A probably benign Het
Olfr1447 A G 19: 12,900,851 *310Q probably null Het
Olfr164 A T 16: 19,286,302 M147K probably benign Het
Olfr791 T A 10: 129,527,049 V274D probably damaging Het
Pepd T C 7: 34,971,676 V215A probably benign Het
Pfkl A T 10: 78,001,426 N104K probably damaging Het
Phf24 T C 4: 42,938,165 probably benign Het
Pink1 T C 4: 138,314,020 N530S probably benign Het
Pou3f2 T C 4: 22,487,119 D338G probably damaging Het
Ppp1r13b A G 12: 111,834,810 V480A probably damaging Het
Ptgfrn A T 3: 101,056,307 I663N probably benign Het
Rad54b A C 4: 11,601,693 N416T probably damaging Het
Rasef A G 4: 73,744,114 S200P possibly damaging Het
Rbm33 T A 5: 28,387,917 I605N probably damaging Het
Rps19bp1 T C 15: 80,264,079 T31A probably benign Het
Ryr2 T A 13: 11,556,698 T4885S possibly damaging Het
Serpinb6b A G 13: 32,978,240 I222V probably benign Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Skor2 T C 18: 76,859,356 S258P unknown Het
Slc22a29 C T 19: 8,217,759 probably null Het
Slc8a3 A T 12: 81,314,844 F400L probably damaging Het
Slc9a8 T C 2: 167,424,214 I37T possibly damaging Het
Smchd1 A G 17: 71,407,237 I877T possibly damaging Het
Spag5 A G 11: 78,304,176 N103S probably benign Het
Sptbn1 A T 11: 30,142,414 F450L probably damaging Het
Strn4 T A 7: 16,833,921 Y507N probably damaging Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Syt17 G T 7: 118,433,985 L267I possibly damaging Het
Tdo2 T A 3: 81,958,940 R339W probably damaging Het
Ttn A G 2: 76,741,401 S26383P probably damaging Het
Ttn G T 2: 76,808,524 T13938K probably damaging Het
Tulp2 A G 7: 45,517,941 N188D possibly damaging Het
Ube3c C T 5: 29,587,317 R37C probably damaging Het
Uggt2 G T 14: 119,008,055 probably benign Het
Umodl1 G A 17: 30,984,043 V457M probably damaging Het
Usp17la C T 7: 104,860,746 T186I probably benign Het
Vmn1r226 T C 17: 20,687,580 S25P probably damaging Het
Vmn1r235 T A 17: 21,262,397 I328K possibly damaging Het
Vmn2r50 A T 7: 10,047,683 S378R probably benign Het
Vwa2 C T 19: 56,908,934 T557I probably benign Het
Wdr60 A C 12: 116,232,601 S509A probably damaging Het
Yes1 G T 5: 32,684,735 Q534H probably benign Het
Zbtb25 A T 12: 76,349,301 Y382* probably null Het
Zc3h3 G A 15: 75,777,118 P722S probably damaging Het
Zfp36l2 T C 17: 84,186,736 T158A probably damaging Het
Zfp536 T C 7: 37,480,199 T994A probably damaging Het
Zfp592 C T 7: 81,037,420 Q824* probably null Het
Zfp629 C A 7: 127,612,000 K212N probably damaging Het
Zfp930 C A 8: 69,228,705 Q350K probably benign Het
Other mutations in Ctnnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0092:Ctnnb1 UTSW 9 120952863 missense possibly damaging 0.78
R0326:Ctnnb1 UTSW 9 120951712 missense probably benign 0.01
R0561:Ctnnb1 UTSW 9 120951722 missense probably damaging 0.97
R1017:Ctnnb1 UTSW 9 120950728 missense probably damaging 0.99
R3892:Ctnnb1 UTSW 9 120950514 splice site probably benign
R3915:Ctnnb1 UTSW 9 120955651 missense probably benign 0.00
R4869:Ctnnb1 UTSW 9 120952994 missense possibly damaging 0.93
R5707:Ctnnb1 UTSW 9 120955168 missense probably benign 0.01
R6744:Ctnnb1 UTSW 9 120952959 missense probably damaging 0.99
R7466:Ctnnb1 UTSW 9 120955416 missense probably damaging 1.00
R7707:Ctnnb1 UTSW 9 120952865 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TTGACAGGGCTGTGTGACAG -3'
(R):5'- TGGCATCCCCTTGAGAACTTC -3'

Sequencing Primer
(F):5'- AGTCCCACATGCCTAGTGAGTG -3'
(R):5'- TGAGAACTTCCCTCAAAGTAAACTG -3'
Posted On2014-07-14