Mutagenetix > Incidental Mutation

Incidental Mutation 'R1918:Spag5'

212751

Institutional Source

Beutler Lab

Gene Symbol

Spag5

Ensembl Gene

ENSMUSG00000002055

Gene Name

sperm associated antigen 5

Synonyms

D11Bhm180e, Astrin, MAP126, Deepest, Mastrin, S17, s17

MMRRC Submission

039936-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1918 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

78301529-78322457 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 78304176 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 103 (N103S)

Ref Sequence

ENSEMBL: ENSMUSP00000045286 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045026]

AlphaFold

Q7TME2

Predicted Effect

probably benign
Transcript: ENSMUST00000045026
AA Change: N103S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000045286
Gene: ENSMUSG00000002055
AA Change: N103S

Domain	Start	End	E-Value	Type
low complexity region	405	420	N/A	INTRINSIC
low complexity region	477	493	N/A	INTRINSIC
coiled coil region	514	547	N/A	INTRINSIC
coiled coil region	638	700	N/A	INTRINSIC
coiled coil region	743	854	N/A	INTRINSIC
low complexity region	898	912	N/A	INTRINSIC
coiled coil region	970	1006	N/A	INTRINSIC
coiled coil region	1032	1068	N/A	INTRINSIC
coiled coil region	1104	1140	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133579

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146068

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.7%
20x: 93.5%

Validation Efficiency

97% (113/116)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the mitotic spindle apparatus. The encoded protein may be involved in the functional and dynamic regulation of mitotic spindles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile with normal breeding and mating behavio; no abnormalities in male reproductive system anatomy or histology or in spermatogenesis were detectable. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 116 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110035E14Rik	T	C	1: 9,601,627	F15S	probably damaging	Het
4930432E11Rik	T	G	7: 29,574,089		noncoding transcript	Het
4930435E12Rik	A	G	16: 38,828,088	Y220H	possibly damaging	Het
4931440F15Rik	A	G	11: 29,824,039	S473P	probably benign	Het
A2m	T	C	6: 121,644,936	S314P	probably benign	Het
Abcc9	T	A	6: 142,697,682	I47F	probably damaging	Het
Abcd2	C	T	15: 91,191,481	R43H	probably benign	Het
Adgre5	A	G	8: 83,729,109	V190A	probably damaging	Het
Aen	C	T	7: 78,906,029	H242Y	possibly damaging	Het
Arfgef1	C	T	1: 10,199,878	A349T	probably benign	Het
Arhgap10	T	C	8: 77,259,079	I698V	probably benign	Het
Arpp21	C	T	9: 112,119,178		probably benign	Het
Atp10a	T	C	7: 58,827,935	I1294T	possibly damaging	Het
Atp13a2	T	C	4: 140,996,371	Y337H	possibly damaging	Het
BC147527	T	C	13: 120,308,222	L26P	probably damaging	Het
Bsn	C	T	9: 108,107,573	G3094D	unknown	Het
Cadm2	G	A	16: 66,747,384		probably benign	Het
Cadps	T	C	14: 12,546,372	M495V	probably damaging	Het
Cass4	A	G	2: 172,427,339	H447R	possibly damaging	Het
Ccdc124	C	A	8: 70,868,944	R108L	probably benign	Het
Ccdc141	C	T	2: 77,014,703	R1340Q	probably benign	Het
Ccdc148	T	G	2: 58,982,899	R299S	probably damaging	Het
Ccdc36	T	A	9: 108,412,985	H140L	probably benign	Het
Cd300lg	A	G	11: 102,054,110	E382G	probably damaging	Het
Cd36	A	T	5: 17,797,036	C322*	probably null	Het
Celsr2	C	T	3: 108,398,650	G2046D	probably benign	Het
Clasrp	C	T	7: 19,585,263	W492*	probably null	Het
Cmtr1	T	C	17: 29,679,009	V154A	possibly damaging	Het
Ctnnb1	C	T	9: 120,951,034	P128S	possibly damaging	Het
Cyp11a1	A	G	9: 58,026,757	I496V	probably damaging	Het
Disp2	G	A	2: 118,791,927	V1047I	probably benign	Het
Eps8l2	T	C	7: 141,361,724	V636A	probably damaging	Het
Fars2	T	C	13: 36,204,546	L6P	probably damaging	Het
Fnip1	C	T	11: 54,480,684	T177I	probably damaging	Het
Fut8	G	T	12: 77,332,218	R31L	probably benign	Het
G6pd2	T	C	5: 61,810,321	F480L	probably benign	Het
Glipr1l2	T	A	10: 112,092,645	C148*	probably null	Het
Gm10142	G	A	10: 77,715,987	V61M	probably benign	Het
Gm12169	A	G	11: 46,528,531	D58G	possibly damaging	Het
Gm5134	T	A	10: 75,976,346	M145K	possibly damaging	Het
Gm853	A	T	4: 130,211,393	V328D	probably benign	Het
Gnpda1	T	C	18: 38,333,190		probably null	Het
Gpc2	T	C	5: 138,278,379	T162A	probably benign	Het
Gtf2h4	G	A	17: 35,670,198	L246F	possibly damaging	Het
Hal	C	T	10: 93,496,607	P294S	probably damaging	Het
Hectd3	C	T	4: 117,000,343	A573V	possibly damaging	Het
Hephl1	T	A	9: 15,076,818	I665F	probably benign	Het
Herc1	T	C	9: 66,476,126		probably null	Het
Hif1an	A	G	19: 44,571,112		probably null	Het
Il12rb1	T	A	8: 70,813,680	M223K	probably benign	Het
Ilf3	C	T	9: 21,393,714	T201M	probably damaging	Het
Inpp5f	T	C	7: 128,663,969		probably benign	Het
Jcad	T	C	18: 4,674,292	Y685H	probably damaging	Het
Kcnj1	C	A	9: 32,396,738	Q153K	probably benign	Het
Kctd18	A	C	1: 57,959,220	H73Q	probably damaging	Het
Klhl36	T	A	8: 119,876,724	W573R	probably damaging	Het
Lepr	A	G	4: 101,772,836	T583A	probably benign	Het
Ltbp4	G	A	7: 27,337,569		probably benign	Het
Mapt	A	T	11: 104,298,499	E114D	probably benign	Het
Mib1	T	A	18: 10,740,972		probably null	Het
Mthfd1	G	T	12: 76,314,976	A119S	probably damaging	Het
Mylk4	A	T	13: 32,724,853	D90E	probably benign	Het
Nceh1	T	G	3: 27,183,175	L33R	probably damaging	Het
Nfat5	T	C	8: 107,366,236	I91T	probably damaging	Het
Nxn	A	G	11: 76,261,672		probably benign	Het
Oasl1	G	A	5: 114,923,469	A20T	possibly damaging	Het
Olfr1262	T	C	2: 90,002,574	F56S	probably benign	Het
Olfr141	C	T	2: 86,806,827	M57I	probably damaging	Het
Olfr1428	A	G	19: 12,109,507	V13A	probably benign	Het
Olfr1447	A	G	19: 12,900,851	*310Q	probably null	Het
Olfr164	A	T	16: 19,286,302	M147K	probably benign	Het
Olfr791	T	A	10: 129,527,049	V274D	probably damaging	Het
Pepd	T	C	7: 34,971,676	V215A	probably benign	Het
Pfkl	A	T	10: 78,001,426	N104K	probably damaging	Het
Phf24	T	C	4: 42,938,165		probably benign	Het
Pink1	T	C	4: 138,314,020	N530S	probably benign	Het
Pou3f2	T	C	4: 22,487,119	D338G	probably damaging	Het
Ppp1r13b	A	G	12: 111,834,810	V480A	probably damaging	Het
Ptgfrn	A	T	3: 101,056,307	I663N	probably benign	Het
Rad54b	A	C	4: 11,601,693	N416T	probably damaging	Het
Rasef	A	G	4: 73,744,114	S200P	possibly damaging	Het
Rbm33	T	A	5: 28,387,917	I605N	probably damaging	Het
Rps19bp1	T	C	15: 80,264,079	T31A	probably benign	Het
Ryr2	T	A	13: 11,556,698	T4885S	possibly damaging	Het
Serpinb6b	A	G	13: 32,978,240	I222V	probably benign	Het
Sik3	C	G	9: 46,221,089	H1276Q	probably benign	Het
Skor2	T	C	18: 76,859,356	S258P	unknown	Het
Slc22a29	C	T	19: 8,217,759		probably null	Het
Slc8a3	A	T	12: 81,314,844	F400L	probably damaging	Het
Slc9a8	T	C	2: 167,424,214	I37T	possibly damaging	Het
Smchd1	A	G	17: 71,407,237	I877T	possibly damaging	Het
Sptbn1	A	T	11: 30,142,414	F450L	probably damaging	Het
Strn4	T	A	7: 16,833,921	Y507N	probably damaging	Het
Stxbp5	C	A	10: 9,812,298	V420F	possibly damaging	Het
Syt17	G	T	7: 118,433,985	L267I	possibly damaging	Het
Tdo2	T	A	3: 81,958,940	R339W	probably damaging	Het
Ttn	A	G	2: 76,741,401	S26383P	probably damaging	Het
Ttn	G	T	2: 76,808,524	T13938K	probably damaging	Het
Tulp2	A	G	7: 45,517,941	N188D	possibly damaging	Het
Ube3c	C	T	5: 29,587,317	R37C	probably damaging	Het
Uggt2	G	T	14: 119,008,055		probably benign	Het
Umodl1	G	A	17: 30,984,043	V457M	probably damaging	Het
Usp17la	C	T	7: 104,860,746	T186I	probably benign	Het
Vmn1r226	T	C	17: 20,687,580	S25P	probably damaging	Het
Vmn1r235	T	A	17: 21,262,397	I328K	possibly damaging	Het
Vmn2r50	A	T	7: 10,047,683	S378R	probably benign	Het
Vwa2	C	T	19: 56,908,934	T557I	probably benign	Het
Wdr60	A	C	12: 116,232,601	S509A	probably damaging	Het
Yes1	G	T	5: 32,684,735	Q534H	probably benign	Het
Zbtb25	A	T	12: 76,349,301	Y382*	probably null	Het
Zc3h3	G	A	15: 75,777,118	P722S	probably damaging	Het
Zfp36l2	T	C	17: 84,186,736	T158A	probably damaging	Het
Zfp536	T	C	7: 37,480,199	T994A	probably damaging	Het
Zfp592	C	T	7: 81,037,420	Q824*	probably null	Het
Zfp629	C	A	7: 127,612,000	K212N	probably damaging	Het
Zfp930	C	A	8: 69,228,705	Q350K	probably benign	Het

Other mutations in Spag5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01380:Spag5	APN	11	78304617	missense	possibly damaging	0.62
IGL01820:Spag5	APN	11	78304259	missense	probably benign	0.06
IGL02066:Spag5	APN	11	78304532	missense	probably benign
IGL02140:Spag5	APN	11	78315633	missense	possibly damaging	0.62
IGL02251:Spag5	APN	11	78320034	missense	probably damaging	1.00
IGL02452:Spag5	APN	11	78304623	missense	probably benign	0.08
IGL02658:Spag5	APN	11	78321331	nonsense	probably null
boyardee	UTSW	11	78313191	critical splice donor site	probably null
Franco	UTSW	11	78314182	nonsense	probably null
spaghetto	UTSW	11	78313379	nonsense	probably null
IGL02991:Spag5	UTSW	11	78314251	missense	probably damaging	0.99
R0477:Spag5	UTSW	11	78314198	missense	probably damaging	1.00
R0512:Spag5	UTSW	11	78319586	unclassified	probably benign
R0535:Spag5	UTSW	11	78304728	missense	probably benign	0.00
R0557:Spag5	UTSW	11	78314211	missense	probably damaging	0.99
R0584:Spag5	UTSW	11	78304095	missense	possibly damaging	0.49
R0666:Spag5	UTSW	11	78313396	missense	probably damaging	1.00
R0723:Spag5	UTSW	11	78319584	unclassified	probably benign
R1413:Spag5	UTSW	11	78305317	nonsense	probably null
R1680:Spag5	UTSW	11	78320616	missense	probably damaging	1.00
R1687:Spag5	UTSW	11	78304929	missense	probably benign	0.32
R1696:Spag5	UTSW	11	78321326	missense	probably damaging	1.00
R1831:Spag5	UTSW	11	78314256	missense	probably benign	0.08
R1866:Spag5	UTSW	11	78304455	missense	possibly damaging	0.62
R4004:Spag5	UTSW	11	78321529	missense	probably benign	0.22
R4005:Spag5	UTSW	11	78321529	missense	probably benign	0.22
R4222:Spag5	UTSW	11	78304511	missense	probably damaging	1.00
R4750:Spag5	UTSW	11	78320052	missense	probably benign	0.00
R4771:Spag5	UTSW	11	78304766	missense	probably damaging	1.00
R4928:Spag5	UTSW	11	78314373	missense	probably damaging	0.97
R5360:Spag5	UTSW	11	78314762	missense	probably damaging	0.99
R5366:Spag5	UTSW	11	78320326	splice site	probably null
R5618:Spag5	UTSW	11	78304080	missense	probably benign	0.00
R5668:Spag5	UTSW	11	78304716	missense	possibly damaging	0.53
R5762:Spag5	UTSW	11	78304146	missense	probably benign	0.25
R5859:Spag5	UTSW	11	78313534	missense	probably benign	0.38
R6564:Spag5	UTSW	11	78315575	missense	probably damaging	1.00
R6571:Spag5	UTSW	11	78321269	missense	probably damaging	1.00
R6573:Spag5	UTSW	11	78314182	nonsense	probably null
R7074:Spag5	UTSW	11	78305042	critical splice donor site	probably null
R7091:Spag5	UTSW	11	78313191	critical splice donor site	probably null
R7332:Spag5	UTSW	11	78313379	nonsense	probably null
R8073:Spag5	UTSW	11	78301977	missense	probably benign	0.22
R8709:Spag5	UTSW	11	78301912	missense	probably benign
R8723:Spag5	UTSW	11	78321389	missense	probably damaging	1.00
R8976:Spag5	UTSW	11	78304587	missense	probably benign	0.01
R9053:Spag5	UTSW	11	78321749	missense	probably benign	0.14
R9142:Spag5	UTSW	11	78301997	missense	possibly damaging	0.56
Z1176:Spag5	UTSW	11	78314982	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- GGGCTGAATTGGACTCCCTTAG -3'
(R):5'- TGTCTTCCACACAAGGTGCC -3'

Sequencing Primer
(F):5'- AGTCAGCTATTATGTTTCTTTTGGC -3'
(R):5'- GCCCCAAAGATTCATTTAGAGAG -3'

Posted On

2014-07-14