Incidental Mutation 'R1918:Ryr2'
ID212760
Institutional Source Beutler Lab
Gene Symbol Ryr2
Ensembl Gene ENSMUSG00000021313
Gene Nameryanodine receptor 2, cardiac
Synonyms9330127I20Rik
MMRRC Submission 039936-MU
Accession Numbers

Ncbi RefSeq: NM_023868.2; MGI: 99685

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1918 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location11553102-12106945 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 11556698 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 4885 (T4885S)
Ref Sequence ENSEMBL: ENSMUSP00000127991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021750] [ENSMUST00000170156]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021750
AA Change: T4885S

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021750
Gene: ENSMUSG00000021313
AA Change: T4885S

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 454 648 3.1e-65 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 862 952 1.8e-36 PFAM
Pfam:RyR 976 1066 1.1e-32 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2122 2331 1.2e-71 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2700 2790 1.1e-33 PFAM
Pfam:RyR 2820 2904 7.1e-27 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3829 3947 3.1e-36 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.7e-96 PFAM
Pfam:Ion_trans 4710 4877 8e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170156
AA Change: T4885S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127991
Gene: ENSMUSG00000021313
AA Change: T4885S

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 451 655 3.5e-73 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 861 955 1.4e-33 PFAM
Pfam:RyR 975 1069 9.2e-34 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2120 2331 3.9e-65 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2699 2793 1.1e-37 PFAM
Pfam:RyR 2819 2907 9.4e-34 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3825 3958 2.3e-42 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.1e-93 PFAM
Pfam:Ion_trans 4705 4865 9.3e-11 PFAM
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.5%
Validation Efficiency 97% (113/116)
MGI Phenotype Strain: 3640298
Lethality: E9-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show embryonic lethality during organogenesis and altered cardiomyocyte morphology. Homozygotes for a phosphorylation defective allele show decreased susceptibility to myocardial infarction-induced heart failure. Homozygotes for the R420W allele show lymphoid organ hypertrophy. [provided by MGI curators]
Allele List at MGI

All alleles(44) : Targeted(17) Gene trapped(27)

Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110035E14Rik T C 1: 9,601,627 F15S probably damaging Het
4930432E11Rik T G 7: 29,574,089 noncoding transcript Het
4930435E12Rik A G 16: 38,828,088 Y220H possibly damaging Het
4931440F15Rik A G 11: 29,824,039 S473P probably benign Het
A2m T C 6: 121,644,936 S314P probably benign Het
Abcc9 T A 6: 142,697,682 I47F probably damaging Het
Abcd2 C T 15: 91,191,481 R43H probably benign Het
Adgre5 A G 8: 83,729,109 V190A probably damaging Het
Aen C T 7: 78,906,029 H242Y possibly damaging Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgap10 T C 8: 77,259,079 I698V probably benign Het
Arpp21 C T 9: 112,119,178 probably benign Het
Atp10a T C 7: 58,827,935 I1294T possibly damaging Het
Atp13a2 T C 4: 140,996,371 Y337H possibly damaging Het
BC147527 T C 13: 120,308,222 L26P probably damaging Het
Bsn C T 9: 108,107,573 G3094D unknown Het
Cadm2 G A 16: 66,747,384 probably benign Het
Cadps T C 14: 12,546,372 M495V probably damaging Het
Cass4 A G 2: 172,427,339 H447R possibly damaging Het
Ccdc124 C A 8: 70,868,944 R108L probably benign Het
Ccdc141 C T 2: 77,014,703 R1340Q probably benign Het
Ccdc148 T G 2: 58,982,899 R299S probably damaging Het
Ccdc36 T A 9: 108,412,985 H140L probably benign Het
Cd300lg A G 11: 102,054,110 E382G probably damaging Het
Cd36 A T 5: 17,797,036 C322* probably null Het
Celsr2 C T 3: 108,398,650 G2046D probably benign Het
Clasrp C T 7: 19,585,263 W492* probably null Het
Cmtr1 T C 17: 29,679,009 V154A possibly damaging Het
Ctnnb1 C T 9: 120,951,034 P128S possibly damaging Het
Cyp11a1 A G 9: 58,026,757 I496V probably damaging Het
Disp2 G A 2: 118,791,927 V1047I probably benign Het
Eps8l2 T C 7: 141,361,724 V636A probably damaging Het
Fars2 T C 13: 36,204,546 L6P probably damaging Het
Fnip1 C T 11: 54,480,684 T177I probably damaging Het
Fut8 G T 12: 77,332,218 R31L probably benign Het
G6pd2 T C 5: 61,810,321 F480L probably benign Het
Glipr1l2 T A 10: 112,092,645 C148* probably null Het
Gm10142 G A 10: 77,715,987 V61M probably benign Het
Gm12169 A G 11: 46,528,531 D58G possibly damaging Het
Gm5134 T A 10: 75,976,346 M145K possibly damaging Het
Gm853 A T 4: 130,211,393 V328D probably benign Het
Gnpda1 T C 18: 38,333,190 probably null Het
Gpc2 T C 5: 138,278,379 T162A probably benign Het
Gtf2h4 G A 17: 35,670,198 L246F possibly damaging Het
Hal C T 10: 93,496,607 P294S probably damaging Het
Hectd3 C T 4: 117,000,343 A573V possibly damaging Het
Hephl1 T A 9: 15,076,818 I665F probably benign Het
Herc1 T C 9: 66,476,126 probably null Het
Hif1an A G 19: 44,571,112 probably null Het
Il12rb1 T A 8: 70,813,680 M223K probably benign Het
Ilf3 C T 9: 21,393,714 T201M probably damaging Het
Inpp5f T C 7: 128,663,969 probably benign Het
Jcad T C 18: 4,674,292 Y685H probably damaging Het
Kcnj1 C A 9: 32,396,738 Q153K probably benign Het
Kctd18 A C 1: 57,959,220 H73Q probably damaging Het
Klhl36 T A 8: 119,876,724 W573R probably damaging Het
Lepr A G 4: 101,772,836 T583A probably benign Het
Ltbp4 G A 7: 27,337,569 probably benign Het
Mapt A T 11: 104,298,499 E114D probably benign Het
Mib1 T A 18: 10,740,972 probably null Het
Mthfd1 G T 12: 76,314,976 A119S probably damaging Het
Mylk4 A T 13: 32,724,853 D90E probably benign Het
Nceh1 T G 3: 27,183,175 L33R probably damaging Het
Nfat5 T C 8: 107,366,236 I91T probably damaging Het
Nxn A G 11: 76,261,672 probably benign Het
Oasl1 G A 5: 114,923,469 A20T possibly damaging Het
Olfr1262 T C 2: 90,002,574 F56S probably benign Het
Olfr141 C T 2: 86,806,827 M57I probably damaging Het
Olfr1428 A G 19: 12,109,507 V13A probably benign Het
Olfr1447 A G 19: 12,900,851 *310Q probably null Het
Olfr164 A T 16: 19,286,302 M147K probably benign Het
Olfr791 T A 10: 129,527,049 V274D probably damaging Het
Pepd T C 7: 34,971,676 V215A probably benign Het
Pfkl A T 10: 78,001,426 N104K probably damaging Het
Phf24 T C 4: 42,938,165 probably benign Het
Pink1 T C 4: 138,314,020 N530S probably benign Het
Pou3f2 T C 4: 22,487,119 D338G probably damaging Het
Ppp1r13b A G 12: 111,834,810 V480A probably damaging Het
Ptgfrn A T 3: 101,056,307 I663N probably benign Het
Rad54b A C 4: 11,601,693 N416T probably damaging Het
Rasef A G 4: 73,744,114 S200P possibly damaging Het
Rbm33 T A 5: 28,387,917 I605N probably damaging Het
Rps19bp1 T C 15: 80,264,079 T31A probably benign Het
Serpinb6b A G 13: 32,978,240 I222V probably benign Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Skor2 T C 18: 76,859,356 S258P unknown Het
Slc22a29 C T 19: 8,217,759 probably null Het
Slc8a3 A T 12: 81,314,844 F400L probably damaging Het
Slc9a8 T C 2: 167,424,214 I37T possibly damaging Het
Smchd1 A G 17: 71,407,237 I877T possibly damaging Het
Spag5 A G 11: 78,304,176 N103S probably benign Het
Sptbn1 A T 11: 30,142,414 F450L probably damaging Het
Strn4 T A 7: 16,833,921 Y507N probably damaging Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Syt17 G T 7: 118,433,985 L267I possibly damaging Het
Tdo2 T A 3: 81,958,940 R339W probably damaging Het
Ttn A G 2: 76,741,401 S26383P probably damaging Het
Ttn G T 2: 76,808,524 T13938K probably damaging Het
Tulp2 A G 7: 45,517,941 N188D possibly damaging Het
Ube3c C T 5: 29,587,317 R37C probably damaging Het
Uggt2 G T 14: 119,008,055 probably benign Het
Umodl1 G A 17: 30,984,043 V457M probably damaging Het
Usp17la C T 7: 104,860,746 T186I probably benign Het
Vmn1r226 T C 17: 20,687,580 S25P probably damaging Het
Vmn1r235 T A 17: 21,262,397 I328K possibly damaging Het
Vmn2r50 A T 7: 10,047,683 S378R probably benign Het
Vwa2 C T 19: 56,908,934 T557I probably benign Het
Wdr60 A C 12: 116,232,601 S509A probably damaging Het
Yes1 G T 5: 32,684,735 Q534H probably benign Het
Zbtb25 A T 12: 76,349,301 Y382* probably null Het
Zc3h3 G A 15: 75,777,118 P722S probably damaging Het
Zfp36l2 T C 17: 84,186,736 T158A probably damaging Het
Zfp536 T C 7: 37,480,199 T994A probably damaging Het
Zfp592 C T 7: 81,037,420 Q824* probably null Het
Zfp629 C A 7: 127,612,000 K212N probably damaging Het
Zfp930 C A 8: 69,228,705 Q350K probably benign Het
Other mutations in Ryr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Ryr2 APN 13 11834092 splice site probably benign
IGL00757:Ryr2 APN 13 11618604 splice site probably null
IGL00838:Ryr2 APN 13 11568503 missense probably damaging 0.98
IGL00849:Ryr2 APN 13 11585478 missense possibly damaging 0.91
IGL00987:Ryr2 APN 13 11735502 missense probably damaging 0.99
IGL01096:Ryr2 APN 13 11703544 missense probably damaging 1.00
IGL01313:Ryr2 APN 13 11638485 critical splice acceptor site probably null
IGL01349:Ryr2 APN 13 11587239 missense possibly damaging 0.93
IGL01391:Ryr2 APN 13 11556685 missense possibly damaging 0.96
IGL01401:Ryr2 APN 13 11591352 missense possibly damaging 0.80
IGL01412:Ryr2 APN 13 11742036 missense probably benign 0.10
IGL01419:Ryr2 APN 13 11799837 missense possibly damaging 0.51
IGL01432:Ryr2 APN 13 11851204 missense possibly damaging 0.63
IGL01533:Ryr2 APN 13 11721790 missense probably damaging 1.00
IGL01571:Ryr2 APN 13 11721761 missense probably damaging 1.00
IGL01584:Ryr2 APN 13 11601758 critical splice donor site probably null
IGL01611:Ryr2 APN 13 11591316 missense possibly damaging 0.67
IGL01632:Ryr2 APN 13 11594968 missense probably damaging 0.97
IGL01643:Ryr2 APN 13 11692677 missense possibly damaging 0.94
IGL01647:Ryr2 APN 13 11585480 missense probably damaging 1.00
IGL01730:Ryr2 APN 13 11601842 missense possibly damaging 0.86
IGL01834:Ryr2 APN 13 11595425 missense possibly damaging 0.71
IGL01921:Ryr2 APN 13 11554550 missense possibly damaging 0.96
IGL01937:Ryr2 APN 13 11790363 missense probably damaging 1.00
IGL01945:Ryr2 APN 13 11790363 missense probably damaging 1.00
IGL02027:Ryr2 APN 13 11597112 missense probably damaging 1.00
IGL02060:Ryr2 APN 13 11747564 missense probably damaging 1.00
IGL02065:Ryr2 APN 13 11572257 missense possibly damaging 0.92
IGL02084:Ryr2 APN 13 11792762 nonsense probably null
IGL02086:Ryr2 APN 13 11735556 missense probably damaging 1.00
IGL02095:Ryr2 APN 13 11759759 missense probably damaging 0.98
IGL02100:Ryr2 APN 13 11737873 missense possibly damaging 0.92
IGL02122:Ryr2 APN 13 11741869 missense probably damaging 1.00
IGL02202:Ryr2 APN 13 11730388 missense probably damaging 0.97
IGL02202:Ryr2 APN 13 11747658 splice site probably benign
IGL02369:Ryr2 APN 13 11619496 missense possibly damaging 0.68
IGL02383:Ryr2 APN 13 11722721 splice site probably benign
IGL02400:Ryr2 APN 13 11605244 splice site probably benign
IGL02423:Ryr2 APN 13 11745198 missense probably damaging 1.00
IGL02425:Ryr2 APN 13 11745674 missense probably damaging 0.99
IGL02458:Ryr2 APN 13 11705699 missense probably benign 0.15
IGL02602:Ryr2 APN 13 11554511 utr 3 prime probably benign
IGL02694:Ryr2 APN 13 11605189 missense probably damaging 1.00
IGL02726:Ryr2 APN 13 11738320 missense probably damaging 1.00
IGL02747:Ryr2 APN 13 11655677 missense probably damaging 1.00
IGL02795:Ryr2 APN 13 11595190 missense probably benign 0.21
IGL02876:Ryr2 APN 13 11707793 missense probably benign 0.39
IGL02878:Ryr2 APN 13 11918319 missense probably benign 0.10
IGL02887:Ryr2 APN 13 11591269 missense probably damaging 0.97
IGL02926:Ryr2 APN 13 11759835 missense probably damaging 0.99
IGL03030:Ryr2 APN 13 11684479 missense probably damaging 0.99
IGL03064:Ryr2 APN 13 11643902 critical splice acceptor site probably null
IGL03102:Ryr2 APN 13 11635582 splice site probably benign
IGL03152:Ryr2 APN 13 11853150 missense probably damaging 1.00
IGL03176:Ryr2 APN 13 11742023 nonsense probably null
IGL03180:Ryr2 APN 13 11568563 missense possibly damaging 0.95
IGL03213:Ryr2 APN 13 11724387 splice site probably benign
IGL03390:Ryr2 APN 13 11772416 missense probably benign
IGL03410:Ryr2 APN 13 11588147 missense probably damaging 0.99
Arruda UTSW 13 11643895 missense probably damaging 1.00
arruda2 UTSW 13 11879496 missense probably damaging 1.00
Arruda3 UTSW 13 11555448 missense possibly damaging 0.91
H8562:Ryr2 UTSW 13 11717141 splice site probably benign
IGL02799:Ryr2 UTSW 13 11665962 missense probably damaging 1.00
IGL02991:Ryr2 UTSW 13 11761306 missense probably damaging 0.99
PIT4142001:Ryr2 UTSW 13 11707796 missense probably damaging 0.97
PIT4260001:Ryr2 UTSW 13 11594755 missense possibly damaging 0.93
PIT4458001:Ryr2 UTSW 13 11555448 missense probably benign 0.29
R0003:Ryr2 UTSW 13 11824379 missense probably damaging 1.00
R0004:Ryr2 UTSW 13 11665919 missense probably benign
R0018:Ryr2 UTSW 13 11595223 missense possibly damaging 0.94
R0048:Ryr2 UTSW 13 11595784 missense probably damaging 1.00
R0048:Ryr2 UTSW 13 11595784 missense probably damaging 1.00
R0056:Ryr2 UTSW 13 11669038 missense probably damaging 0.97
R0062:Ryr2 UTSW 13 11869116 critical splice donor site probably null
R0062:Ryr2 UTSW 13 11869116 critical splice donor site probably null
R0080:Ryr2 UTSW 13 11568475 missense probably damaging 0.98
R0116:Ryr2 UTSW 13 11709921 missense probably damaging 1.00
R0148:Ryr2 UTSW 13 11714548 missense probably damaging 1.00
R0206:Ryr2 UTSW 13 11676251 splice site probably benign
R0226:Ryr2 UTSW 13 11772556 missense probably damaging 1.00
R0285:Ryr2 UTSW 13 11716977 missense probably damaging 1.00
R0365:Ryr2 UTSW 13 11668839 missense possibly damaging 0.90
R0401:Ryr2 UTSW 13 11705684 missense probably benign 0.45
R0415:Ryr2 UTSW 13 11869156 missense probably damaging 0.97
R0418:Ryr2 UTSW 13 11834095 splice site probably benign
R0558:Ryr2 UTSW 13 11638443 missense probably damaging 1.00
R0558:Ryr2 UTSW 13 11799861 missense probably damaging 1.00
R0574:Ryr2 UTSW 13 11731669 missense probably benign 0.02
R0586:Ryr2 UTSW 13 11635559 missense probably null
R0601:Ryr2 UTSW 13 11705633 critical splice donor site probably null
R0610:Ryr2 UTSW 13 11622952 missense probably damaging 1.00
R0648:Ryr2 UTSW 13 11724333 missense possibly damaging 0.86
R0727:Ryr2 UTSW 13 11566885 missense probably damaging 1.00
R0743:Ryr2 UTSW 13 11554529 missense probably damaging 0.99
R0821:Ryr2 UTSW 13 11738126 missense probably benign 0.35
R0884:Ryr2 UTSW 13 11554529 missense probably damaging 0.99
R1104:Ryr2 UTSW 13 11669969 missense probably damaging 0.99
R1114:Ryr2 UTSW 13 11945981 missense probably damaging 0.98
R1167:Ryr2 UTSW 13 11660113 missense possibly damaging 0.94
R1238:Ryr2 UTSW 13 11759703 missense probably damaging 1.00
R1239:Ryr2 UTSW 13 11883043 critical splice donor site probably null
R1296:Ryr2 UTSW 13 11687879 splice site probably benign
R1400:Ryr2 UTSW 13 11595076 missense probably benign 0.08
R1439:Ryr2 UTSW 13 11714503 splice site probably benign
R1443:Ryr2 UTSW 13 11779266 missense probably benign 0.19
R1446:Ryr2 UTSW 13 11738149 missense probably benign 0.09
R1458:Ryr2 UTSW 13 11727022 missense probably damaging 0.97
R1497:Ryr2 UTSW 13 11601841 missense probably damaging 0.99
R1505:Ryr2 UTSW 13 11554592 missense possibly damaging 0.84
R1548:Ryr2 UTSW 13 11554549 nonsense probably null
R1551:Ryr2 UTSW 13 11785143 critical splice acceptor site probably null
R1567:Ryr2 UTSW 13 11759677 missense possibly damaging 0.87
R1581:Ryr2 UTSW 13 11794563 missense probably benign 0.01
R1645:Ryr2 UTSW 13 11718482 nonsense probably null
R1686:Ryr2 UTSW 13 11603779 splice site probably benign
R1696:Ryr2 UTSW 13 11731657 missense probably benign 0.02
R1708:Ryr2 UTSW 13 11587442 splice site probably null
R1728:Ryr2 UTSW 13 11587422 missense possibly damaging 0.94
R1745:Ryr2 UTSW 13 11790267 missense probably damaging 1.00
R1771:Ryr2 UTSW 13 11745176 critical splice donor site probably null
R1776:Ryr2 UTSW 13 11745176 critical splice donor site probably null
R1783:Ryr2 UTSW 13 11700371 nonsense probably null
R1801:Ryr2 UTSW 13 11595281 missense probably benign 0.01
R1812:Ryr2 UTSW 13 11560586 missense probably damaging 0.97
R1820:Ryr2 UTSW 13 11587316 missense probably damaging 0.99
R1835:Ryr2 UTSW 13 11769878 missense probably benign 0.06
R1868:Ryr2 UTSW 13 11731700 missense probably benign 0.02
R1869:Ryr2 UTSW 13 11662075 missense probably damaging 0.98
R1884:Ryr2 UTSW 13 11738356 missense probably damaging 0.97
R1892:Ryr2 UTSW 13 11658958 nonsense probably null
R1897:Ryr2 UTSW 13 11750932 missense probably benign 0.09
R1899:Ryr2 UTSW 13 11591336 missense probably benign
R1909:Ryr2 UTSW 13 11700349 missense probably damaging 1.00
R1937:Ryr2 UTSW 13 11668962 missense probably damaging 1.00
R1943:Ryr2 UTSW 13 11731723 missense probably benign 0.10
R1956:Ryr2 UTSW 13 11681080 missense probably damaging 1.00
R1983:Ryr2 UTSW 13 11585402 splice site probably null
R2018:Ryr2 UTSW 13 11851188 missense possibly damaging 0.59
R2019:Ryr2 UTSW 13 11851188 missense possibly damaging 0.59
R2060:Ryr2 UTSW 13 11595736 missense probably damaging 1.00
R2061:Ryr2 UTSW 13 11665878 splice site probably null
R2088:Ryr2 UTSW 13 11662229 missense probably benign 0.04
R2089:Ryr2 UTSW 13 11945977 missense probably benign 0.23
R2091:Ryr2 UTSW 13 11945977 missense probably benign 0.23
R2091:Ryr2 UTSW 13 11945977 missense probably benign 0.23
R2127:Ryr2 UTSW 13 11712195 missense probably damaging 1.00
R2140:Ryr2 UTSW 13 11560607 missense probably damaging 1.00
R2153:Ryr2 UTSW 13 11577873 missense possibly damaging 0.86
R2179:Ryr2 UTSW 13 11705793 nonsense probably null
R2207:Ryr2 UTSW 13 11810937 missense probably damaging 1.00
R2237:Ryr2 UTSW 13 11662260 missense probably benign 0.18
R2258:Ryr2 UTSW 13 11738216 missense possibly damaging 0.94
R2312:Ryr2 UTSW 13 11738242 missense probably damaging 1.00
R2421:Ryr2 UTSW 13 11591237 missense probably damaging 0.98
R2438:Ryr2 UTSW 13 11801848 missense probably damaging 1.00
R2483:Ryr2 UTSW 13 11759703 missense probably damaging 1.00
R2860:Ryr2 UTSW 13 11593093 missense probably damaging 0.98
R2861:Ryr2 UTSW 13 11593093 missense probably damaging 0.98
R2867:Ryr2 UTSW 13 11761349 missense probably damaging 1.00
R2867:Ryr2 UTSW 13 11761349 missense probably damaging 1.00
R3618:Ryr2 UTSW 13 11772580 critical splice acceptor site probably null
R3876:Ryr2 UTSW 13 11588159 missense probably damaging 0.99
R3906:Ryr2 UTSW 13 11738209 missense possibly damaging 0.87
R3912:Ryr2 UTSW 13 11772427 missense probably damaging 0.99
R4018:Ryr2 UTSW 13 11918414 missense probably damaging 1.00
R4114:Ryr2 UTSW 13 11692682 missense probably damaging 1.00
R4119:Ryr2 UTSW 13 11779267 missense probably benign 0.22
R4127:Ryr2 UTSW 13 11587437 missense possibly damaging 0.91
R4222:Ryr2 UTSW 13 11737873 missense possibly damaging 0.92
R4233:Ryr2 UTSW 13 11750725 missense probably benign 0.20
R4355:Ryr2 UTSW 13 11649812 missense probably benign 0.05
R4384:Ryr2 UTSW 13 11605233 missense probably damaging 0.99
R4422:Ryr2 UTSW 13 11717066 nonsense probably null
R4430:Ryr2 UTSW 13 11735527 missense probably damaging 0.98
R4624:Ryr2 UTSW 13 12106415 missense possibly damaging 0.47
R4663:Ryr2 UTSW 13 11749509 missense possibly damaging 0.47
R4665:Ryr2 UTSW 13 11750685 splice site probably null
R4668:Ryr2 UTSW 13 11593117 missense probably benign
R4677:Ryr2 UTSW 13 11706667 missense probably damaging 0.98
R4679:Ryr2 UTSW 13 11824369 missense probably benign 0.34
R4680:Ryr2 UTSW 13 11595233 missense probably benign 0.04
R4685:Ryr2 UTSW 13 11692646 missense probably damaging 1.00
R4709:Ryr2 UTSW 13 11716998 missense probably damaging 1.00
R4731:Ryr2 UTSW 13 11577909 missense possibly damaging 0.53
R4732:Ryr2 UTSW 13 11577909 missense possibly damaging 0.53
R4733:Ryr2 UTSW 13 11577909 missense possibly damaging 0.53
R4734:Ryr2 UTSW 13 11737753 missense probably damaging 0.99
R4740:Ryr2 UTSW 13 11657047 missense possibly damaging 0.95
R4801:Ryr2 UTSW 13 11708227 missense probably damaging 1.00
R4801:Ryr2 UTSW 13 11687932 missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11708227 missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11687932 missense probably damaging 1.00
R4804:Ryr2 UTSW 13 11717097 missense probably damaging 1.00
R4811:Ryr2 UTSW 13 11655698 missense probably damaging 0.97
R4850:Ryr2 UTSW 13 11668820 missense probably damaging 0.99
R4850:Ryr2 UTSW 13 11745752 missense probably damaging 1.00
R4880:Ryr2 UTSW 13 11752218 missense probably damaging 1.00
R4917:Ryr2 UTSW 13 11594986 missense probably damaging 0.96
R4918:Ryr2 UTSW 13 11594986 missense probably damaging 0.96
R4922:Ryr2 UTSW 13 11709963 missense probably damaging 0.99
R4933:Ryr2 UTSW 13 11945945 missense probably damaging 0.96
R4950:Ryr2 UTSW 13 11742011 missense probably damaging 1.00
R4957:Ryr2 UTSW 13 11785080 missense probably damaging 0.97
R4964:Ryr2 UTSW 13 11714611 missense possibly damaging 0.49
R4964:Ryr2 UTSW 13 11833992 missense probably benign 0.00
R4966:Ryr2 UTSW 13 11714611 missense possibly damaging 0.49
R4966:Ryr2 UTSW 13 11833992 missense probably benign 0.00
R4997:Ryr2 UTSW 13 11595306 missense probably benign 0.09
R4998:Ryr2 UTSW 13 11643895 missense probably damaging 1.00
R5033:Ryr2 UTSW 13 11587254 missense possibly damaging 0.93
R5061:Ryr2 UTSW 13 11635536 missense possibly damaging 0.74
R5062:Ryr2 UTSW 13 11700354 missense probably damaging 0.97
R5088:Ryr2 UTSW 13 11712243 nonsense probably null
R5135:Ryr2 UTSW 13 11662130 missense probably benign 0.05
R5138:Ryr2 UTSW 13 11660289 missense probably damaging 1.00
R5168:Ryr2 UTSW 13 11752321 missense probably benign
R5187:Ryr2 UTSW 13 11772452 missense probably damaging 0.99
R5197:Ryr2 UTSW 13 11638430 critical splice donor site probably null
R5262:Ryr2 UTSW 13 11772437 missense probably damaging 0.99
R5325:Ryr2 UTSW 13 11690363 missense probably damaging 0.97
R5381:Ryr2 UTSW 13 11556658 missense probably damaging 1.00
R5437:Ryr2 UTSW 13 11655713 missense probably damaging 1.00
R5477:Ryr2 UTSW 13 11705656 missense probably damaging 1.00
R5497:Ryr2 UTSW 13 11705701 missense probably null 0.15
R5509:Ryr2 UTSW 13 11745601 missense probably damaging 0.98
R5518:Ryr2 UTSW 13 11687909 missense probably benign 0.01
R5571:Ryr2 UTSW 13 11555448 missense possibly damaging 0.91
R5591:Ryr2 UTSW 13 11595014 missense probably benign 0.06
R5619:Ryr2 UTSW 13 11708202 missense probably damaging 1.00
R5630:Ryr2 UTSW 13 11601805 missense probably damaging 1.00
R5644:Ryr2 UTSW 13 11595582 missense probably damaging 0.99
R5667:Ryr2 UTSW 13 11759836 missense probably damaging 1.00
R5775:Ryr2 UTSW 13 11769962 missense probably damaging 1.00
R5836:Ryr2 UTSW 13 11603732 missense probably damaging 1.00
R5858:Ryr2 UTSW 13 11560574 missense probably damaging 0.99
R5934:Ryr2 UTSW 13 11584154 missense probably damaging 0.96
R5939:Ryr2 UTSW 13 11790332 missense probably damaging 0.99
R5941:Ryr2 UTSW 13 11687902 missense probably damaging 1.00
R5945:Ryr2 UTSW 13 11660122 missense probably damaging 1.00
R5946:Ryr2 UTSW 13 11726953 missense probably damaging 1.00
R5966:Ryr2 UTSW 13 11662238 nonsense probably null
R5974:Ryr2 UTSW 13 11714511 splice site probably null
R6104:Ryr2 UTSW 13 11799825 missense probably damaging 1.00
R6118:Ryr2 UTSW 13 11792689 missense possibly damaging 0.69
R6149:Ryr2 UTSW 13 11669017 missense probably benign
R6208:Ryr2 UTSW 13 11895220 missense probably benign 0.04
R6217:Ryr2 UTSW 13 11834078 missense probably damaging 1.00
R6230:Ryr2 UTSW 13 11660107 missense probably damaging 0.99
R6279:Ryr2 UTSW 13 11680999 missense probably damaging 0.97
R6294:Ryr2 UTSW 13 11879496 missense probably damaging 1.00
R6300:Ryr2 UTSW 13 11680999 missense probably damaging 0.97
R6350:Ryr2 UTSW 13 11761396 missense probably damaging 0.98
R6484:Ryr2 UTSW 13 11662383 missense possibly damaging 0.90
R6489:Ryr2 UTSW 13 11834007 missense probably benign 0.29
R6548:Ryr2 UTSW 13 11668821 missense probably damaging 1.00
R6591:Ryr2 UTSW 13 11594723 missense probably benign 0.01
R6623:Ryr2 UTSW 13 11710065 missense probably damaging 1.00
R6649:Ryr2 UTSW 13 11595643 missense probably damaging 0.99
R6691:Ryr2 UTSW 13 11594723 missense probably benign 0.01
R6770:Ryr2 UTSW 13 11738462 missense probably damaging 1.00
R6802:Ryr2 UTSW 13 11686966 missense probably damaging 1.00
R6809:Ryr2 UTSW 13 11726930 missense probably damaging 1.00
R6893:Ryr2 UTSW 13 11829654 missense possibly damaging 0.75
R6911:Ryr2 UTSW 13 11827559 missense possibly damaging 0.50
R6915:Ryr2 UTSW 13 11745601 missense probably damaging 1.00
R6943:Ryr2 UTSW 13 11566948 missense possibly damaging 0.92
R6960:Ryr2 UTSW 13 11801243 missense probably benign 0.28
R6997:Ryr2 UTSW 13 11654380 missense possibly damaging 0.88
R6998:Ryr2 UTSW 13 11712166 missense probably damaging 0.99
R7001:Ryr2 UTSW 13 11794605 missense probably damaging 0.98
R7047:Ryr2 UTSW 13 11824400 missense possibly damaging 0.64
R7089:Ryr2 UTSW 13 11649776 missense probably benign 0.10
R7125:Ryr2 UTSW 13 11669987 missense probably damaging 0.99
R7127:Ryr2 UTSW 13 11655713 missense probably damaging 1.00
R7131:Ryr2 UTSW 13 11640327 missense possibly damaging 0.63
R7131:Ryr2 UTSW 13 11668811 critical splice donor site probably null
R7159:Ryr2 UTSW 13 11810908 missense probably damaging 0.99
R7174:Ryr2 UTSW 13 11801177 missense possibly damaging 0.81
R7180:Ryr2 UTSW 13 11686978 missense probably damaging 1.00
R7182:Ryr2 UTSW 13 11759757 missense probably benign
R7189:Ryr2 UTSW 13 11883123 missense probably damaging 1.00
R7241:Ryr2 UTSW 13 11665913 missense possibly damaging 0.71
R7244:Ryr2 UTSW 13 11597146 missense probably damaging 1.00
R7326:Ryr2 UTSW 13 11738194 missense possibly damaging 0.95
R7331:Ryr2 UTSW 13 11745631 missense probably benign
R7365:Ryr2 UTSW 13 11640275 missense probably damaging 0.99
R7372:Ryr2 UTSW 13 11680999 missense probably damaging 0.97
R7395:Ryr2 UTSW 13 11785111 missense probably damaging 0.98
R7404:Ryr2 UTSW 13 11735620 missense probably damaging 0.97
R7425:Ryr2 UTSW 13 11705644 missense probably benign 0.20
R7444:Ryr2 UTSW 13 11555463 missense probably benign 0.25
R7456:Ryr2 UTSW 13 11752282 missense probably benign
R7460:Ryr2 UTSW 13 11705710 missense probably benign 0.10
R7474:Ryr2 UTSW 13 11594876 missense probably benign 0.04
R7543:Ryr2 UTSW 13 11638431 critical splice donor site probably null
R7549:Ryr2 UTSW 13 11737985 missense probably benign 0.15
R7558:Ryr2 UTSW 13 11799825 missense probably damaging 1.00
R7565:Ryr2 UTSW 13 11560653 missense possibly damaging 0.84
S24628:Ryr2 UTSW 13 11869156 missense probably damaging 0.97
X0019:Ryr2 UTSW 13 11703501 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACCTACTCCAAGGGTTCGAGAG -3'
(R):5'- GTTCCTGGTAGATTTCCCAAGC -3'

Sequencing Primer
(F):5'- CGAGAGGACCAGTCTTTTCC -3'
(R):5'- CCAAGCTTCCTGAGTTGTATGAAC -3'
Posted On2014-07-14