Mutagenetix > Incidental Mutation

Incidental Mutation 'R1919:Rp1'

212791

Institutional Source

Beutler Lab

Gene Symbol

Rp1

Ensembl Gene

ENSMUSG00000025900

Gene Name

retinitis pigmentosa 1 (human)

Synonyms

Dcdc3, mG145, Orp1, oxygen-regulated protein 1, Rp1h

MMRRC Submission

039937-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R1919 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

3999557-4409241 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 4352671 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 52 (V52A)

Ref Sequence

ENSEMBL: ENSMUSP00000027032 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027032] [ENSMUST00000194992] [ENSMUST00000208660]

AlphaFold

P56716

Predicted Effect

probably damaging
Transcript: ENSMUST00000027032
AA Change: V52A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000027032
Gene: ENSMUSG00000025900
AA Change: V52A

Domain	Start	End	E-Value	Type
DCX	30	117	4.37e-39	SMART
low complexity region	120	133	N/A	INTRINSIC
DCX	152	236	7.17e-35	SMART
low complexity region	343	354	N/A	INTRINSIC
low complexity region	403	414	N/A	INTRINSIC
low complexity region	462	473	N/A	INTRINSIC
low complexity region	646	661	N/A	INTRINSIC
low complexity region	1113	1123	N/A	INTRINSIC
low complexity region	1396	1412	N/A	INTRINSIC
low complexity region	1434	1444	N/A	INTRINSIC
low complexity region	1648	1661	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000194992
AA Change: V62A

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000142146
Gene: ENSMUSG00000025900
AA Change: V62A

Domain	Start	End	E-Value	Type
DCX	40	127	4.37e-39	SMART
low complexity region	130	143	N/A	INTRINSIC
DCX	162	246	7.17e-35	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000208660
AA Change: V62A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208793

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.7%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains, which bind microtubules and regulate microtubule polymerization. The encoded protein is a photoreceptor microtubule-associated protein and is required for correct stacking of outer segment disc. This protein and the RP1L1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. Because of its response to in vivo retinal oxygen levels, this protein was initially named ORP1 (oxygen-regulated protein-1). This protein was subsequently designated RP1 (retinitis pigmentosa 1) when it was found that mutations in this gene cause autosomal dominant retinitis pigmentosa. Mutations in this gene also cause autosomal recessive retinitis pigmentosa. Two transcript variants encoding distinct isoforms are resulted from alternative promoters and alternative splicing. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience progressive degeneration in photoreceptors but are otherwise phenotypically normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,067,270	E740G	probably damaging	Het
4930474N05Rik	G	T	14: 36,095,457	V105F	possibly damaging	Het
4932438A13Rik	A	G	3: 37,006,983		probably null	Het
Actr10	A	G	12: 70,942,330	I74M	probably benign	Het
Aen	T	C	7: 78,905,912	Y108H	probably damaging	Het
Afm	A	T	5: 90,524,920	K205*	probably null	Het
Ankrd27	T	A	7: 35,632,985	S846T	probably benign	Het
Ano3	A	G	2: 110,885,007	S29P	probably benign	Het
Apaf1	C	T	10: 91,077,614	W138*	probably null	Het
Arfgef1	C	T	1: 10,199,878	A349T	probably benign	Het
Arhgef4	A	G	1: 34,811,140	Q1798R	probably damaging	Het
Astn1	G	A	1: 158,509,971	V416I	probably damaging	Het
Atxn2l	G	A	7: 126,493,168	T70I	probably damaging	Het
Auh	G	A	13: 52,835,496	P308L	probably benign	Het
Bspry	T	A	4: 62,494,797	C256S	probably damaging	Het
C3	C	A	17: 57,220,135	W771C	probably damaging	Het
Camkv	A	G	9: 107,947,088	D233G	possibly damaging	Het
Catsperd	T	A	17: 56,635,548	V109E	probably damaging	Het
Cd101	A	G	3: 101,018,917	L162P	probably damaging	Het
Cdr2l	A	G	11: 115,392,777	T154A	probably damaging	Het
Clca3a2	G	C	3: 144,810,696	Q380E	probably benign	Het
Col6a3	T	C	1: 90,822,359	N251S	possibly damaging	Het
Cttnbp2nl	A	G	3: 105,011,278	V82A	possibly damaging	Het
Cux1	G	A	5: 136,363,319	Q194*	probably null	Het
Daam2	T	C	17: 49,485,457	E361G	probably benign	Het
Dcaf17	A	T	2: 71,078,172		probably null	Het
Dnaic1	T	C	4: 41,570,020		probably null	Het
Eml5	T	C	12: 98,798,839	Y1617C	probably damaging	Het
Epb41l4b	T	C	4: 57,040,993	E490G	probably damaging	Het
Epha7	T	C	4: 28,963,969	M988T	possibly damaging	Het
Fancm	T	C	12: 65,105,520	C917R	possibly damaging	Het
Fnip1	C	T	11: 54,480,684	T177I	probably damaging	Het
Gm12169	A	G	11: 46,528,531	D58G	possibly damaging	Het
Gm3604	G	T	13: 62,369,942	H201N	probably benign	Het
Gnpda1	T	C	18: 38,333,190		probably null	Het
Gpatch8	A	G	11: 102,508,142		probably null	Het
H2-M3	T	C	17: 37,271,189	Y179H	possibly damaging	Het
H2-Q10	C	A	17: 35,470,488	S62R	probably damaging	Het
Hipk2	G	A	6: 38,818,984	R117*	probably null	Het
Hrg	A	T	16: 22,954,457	Q113H	probably damaging	Het
Kcnj16	T	C	11: 111,024,953	V147A	possibly damaging	Het
Kif1a	T	C	1: 93,019,031	I1650V	possibly damaging	Het
Kmt2a	C	T	9: 44,820,345		probably benign	Het
Krt90	A	T	15: 101,557,230	Y319N	probably damaging	Het
Lipo4	T	C	19: 33,499,271	N359S	possibly damaging	Het
Lrp1b	G	T	2: 41,728,729	T225K	probably benign	Het
Map1a	C	T	2: 121,307,012	P2532S	probably damaging	Het
Mmrn2	A	G	14: 34,397,643	D193G	probably benign	Het
Mpped2	T	A	2: 106,867,032	I284N	probably damaging	Het
Msh6	A	G	17: 87,985,125	H436R	probably benign	Het
Mterf3	A	T	13: 66,930,062	S48T	probably damaging	Het
Muc5b	T	C	7: 141,846,031	F414L	unknown	Het
Mylk4	A	T	13: 32,724,853	D90E	probably benign	Het
Nploc4	A	G	11: 120,404,229	Y420H	probably damaging	Het
Npr2	T	A	4: 43,640,578	Y344N	probably damaging	Het
Nsun5	A	G	5: 135,375,598	T397A	probably benign	Het
Ntsr2	A	T	12: 16,654,110	Q204L	probably damaging	Het
Nwd2	T	A	5: 63,806,180	Y1036N	probably damaging	Het
Oacyl	T	C	18: 65,710,547	V105A	possibly damaging	Het
Olfr791	T	A	10: 129,527,049	V274D	probably damaging	Het
Parp3	T	A	9: 106,475,117	Q70L	possibly damaging	Het
Parp4	T	C	14: 56,624,017	S936P	probably damaging	Het
Pdzd3	T	C	9: 44,250,303	D93G	possibly damaging	Het
Phkb	A	G	8: 85,922,161	E202G	probably benign	Het
Pink1	T	C	4: 138,314,020	N530S	probably benign	Het
Pou3f2	T	C	4: 22,487,119	D338G	probably damaging	Het
Prss8	G	T	7: 127,929,858	L9I	probably benign	Het
Ptpn22	G	A	3: 103,876,738		probably null	Het
Rad54b	A	C	4: 11,601,693	N416T	probably damaging	Het
Rasef	A	G	4: 73,744,114	S200P	possibly damaging	Het
Rb1	T	A	14: 73,212,990	K645*	probably null	Het
Robo2	C	T	16: 73,899,154	G1367D	probably benign	Het
Samd13	T	C	3: 146,662,712	T23A	probably benign	Het
Scn7a	T	C	2: 66,699,973	H676R	probably damaging	Het
Serpinb6b	A	G	13: 32,978,240	I222V	probably benign	Het
Slc2a8	T	C	2: 32,980,079	Y150C	probably damaging	Het
Slc7a6os	C	A	8: 106,210,564	R88L	probably damaging	Het
Slc8a2	A	G	7: 16,152,920	I657V	probably benign	Het
Slit2	C	A	5: 48,191,016		probably benign	Het
Spire2	A	G	8: 123,363,071	D447G	probably benign	Het
Sptlc3	A	G	2: 139,566,675	N237D	possibly damaging	Het
Stk3	G	A	15: 35,073,217	T119I	probably damaging	Het
Suv39h2	G	A	2: 3,464,316	T334I	probably damaging	Het
Syt5	G	T	7: 4,540,279	T327N	probably damaging	Het
Tcof1	T	C	18: 60,816,084	D1253G	possibly damaging	Het
Tnks	A	T	8: 34,875,232	V388D	probably damaging	Het
Ugt2b1	T	C	5: 86,926,000	T167A	probably benign	Het
Usp40	G	A	1: 87,995,842	R236C	possibly damaging	Het
Utrn	T	C	10: 12,455,480	D2904G	probably benign	Het
Vmn1r226	T	C	17: 20,687,580	S25P	probably damaging	Het
Vmn2r23	T	C	6: 123,713,010	S282P	possibly damaging	Het
Vps45	T	C	3: 96,046,440	E200G	probably benign	Het
Wnt7b	T	A	15: 85,559,080	I41F	probably damaging	Het
Zmym6	T	A	4: 127,103,414	N275K	probably damaging	Het

Other mutations in Rp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Rp1	APN	1	4346746	missense	probably damaging	0.98
IGL00593:Rp1	APN	1	4345403	missense	possibly damaging	0.70
IGL00956:Rp1	APN	1	4352212	missense	probably damaging	1.00
IGL01070:Rp1	APN	1	4345238	missense	probably damaging	1.00
IGL01531:Rp1	APN	1	4348945	missense	probably benign	0.00
IGL01668:Rp1	APN	1	4345718	missense	probably damaging	1.00
IGL01907:Rp1	APN	1	4348507	missense	possibly damaging	0.56
IGL02055:Rp1	APN	1	4352522	missense	probably damaging	1.00
IGL02071:Rp1	APN	1	4345310	missense	possibly damaging	0.46
IGL02128:Rp1	APN	1	4347385	missense	probably damaging	0.99
IGL02244:Rp1	APN	1	4348780	missense	probably benign	0.00
IGL02381:Rp1	APN	1	4352390	missense	probably benign	0.01
IGL02499:Rp1	APN	1	4349048	missense	probably benign	0.17
IGL02619:Rp1	APN	1	4348450	missense	possibly damaging	0.73
IGL02832:Rp1	APN	1	4349713	missense	probably benign	0.03
IGL02861:Rp1	APN	1	4346152	nonsense	probably null
IGL03288:Rp1	APN	1	4349524	missense	possibly damaging	0.88
IGL03290:Rp1	APN	1	4350041	missense	probably damaging	1.00
IGL03303:Rp1	APN	1	4344817	missense	probably damaging	1.00
R0041:Rp1	UTSW	1	4344628	missense	probably benign	0.36
R0111:Rp1	UTSW	1	4344760	missense	probably damaging	1.00
R0363:Rp1	UTSW	1	4347718	missense	probably damaging	1.00
R0440:Rp1	UTSW	1	4345640	missense	probably damaging	1.00
R0442:Rp1	UTSW	1	4346747	missense	probably benign	0.09
R0528:Rp1	UTSW	1	4344865	missense	possibly damaging	0.82
R0586:Rp1	UTSW	1	4347837	missense	possibly damaging	0.76
R0639:Rp1	UTSW	1	4346498	missense	probably benign	0.00
R0856:Rp1	UTSW	1	4344655	missense	probably benign	0.05
R0908:Rp1	UTSW	1	4344655	missense	probably benign	0.05
R0968:Rp1	UTSW	1	4345352	missense	probably benign	0.00
R1099:Rp1	UTSW	1	4352290	missense	possibly damaging	0.45
R1242:Rp1	UTSW	1	4344962	missense	probably benign	0.03
R1301:Rp1	UTSW	1	4345936	missense	possibly damaging	0.56
R1327:Rp1	UTSW	1	4347970	missense	probably benign	0.01
R1403:Rp1	UTSW	1	4346297	missense	possibly damaging	0.73
R1403:Rp1	UTSW	1	4346297	missense	possibly damaging	0.73
R1406:Rp1	UTSW	1	4351921	missense	possibly damaging	0.88
R1406:Rp1	UTSW	1	4351921	missense	possibly damaging	0.88
R1440:Rp1	UTSW	1	4347396	missense	probably damaging	1.00
R1509:Rp1	UTSW	1	4347694	missense	probably damaging	0.98
R1509:Rp1	UTSW	1	4348537	missense	probably benign	0.20
R1538:Rp1	UTSW	1	4345676	missense	probably damaging	1.00
R1609:Rp1	UTSW	1	4349201	missense	probably damaging	1.00
R1666:Rp1	UTSW	1	4349863	missense	probably damaging	1.00
R1703:Rp1	UTSW	1	4345169	missense	probably damaging	1.00
R1782:Rp1	UTSW	1	4349089	missense	probably benign	0.00
R1799:Rp1	UTSW	1	4348832	missense	possibly damaging	0.94
R1848:Rp1	UTSW	1	4347232	missense	possibly damaging	0.76
R1908:Rp1	UTSW	1	4348720	missense	probably damaging	0.99
R2087:Rp1	UTSW	1	4348352	missense	probably damaging	1.00
R2211:Rp1	UTSW	1	4348139	missense	probably damaging	0.96
R2278:Rp1	UTSW	1	4348027	missense	possibly damaging	0.51
R2287:Rp1	UTSW	1	4345959	nonsense	probably null
R2316:Rp1	UTSW	1	4345640	missense	probably damaging	1.00
R2346:Rp1	UTSW	1	4348013	missense	probably damaging	1.00
R2878:Rp1	UTSW	1	4348139	missense	probably damaging	1.00
R3023:Rp1	UTSW	1	4352675	missense	probably damaging	1.00
R3025:Rp1	UTSW	1	4352675	missense	probably damaging	1.00
R3716:Rp1	UTSW	1	4349765	missense	probably benign	0.38
R3814:Rp1	UTSW	1	4349708	missense	probably benign
R3929:Rp1	UTSW	1	4352645	missense	probably damaging	1.00
R4064:Rp1	UTSW	1	4345400	missense	probably benign	0.08
R4426:Rp1	UTSW	1	4347924	missense	probably benign	0.13
R4557:Rp1	UTSW	1	4344663	missense	possibly damaging	0.61
R4764:Rp1	UTSW	1	4345878	missense	probably damaging	0.96
R4845:Rp1	UTSW	1	4349228	missense	probably benign	0.02
R4850:Rp1	UTSW	1	4348675	missense	probably damaging	1.00
R4857:Rp1	UTSW	1	4352316	missense	probably damaging	0.99
R4857:Rp1	UTSW	1	4352317	missense	probably damaging	1.00
R5159:Rp1	UTSW	1	4346203	missense	possibly damaging	0.73
R5226:Rp1	UTSW	1	4348033	missense	probably benign	0.01
R5327:Rp1	UTSW	1	4349360	splice site	probably null
R5352:Rp1	UTSW	1	4347098	missense	probably benign	0.00
R5504:Rp1	UTSW	1	4349890	missense	probably damaging	1.00
R5527:Rp1	UTSW	1	4346393	missense	possibly damaging	0.75
R5529:Rp1	UTSW	1	4345832	missense	probably benign	0.42
R5569:Rp1	UTSW	1	4345237	missense	probably damaging	1.00
R5622:Rp1	UTSW	1	4347837	missense	possibly damaging	0.76
R5970:Rp1	UTSW	1	4348462	missense	probably benign	0.05
R5992:Rp1	UTSW	1	4148703	missense	unknown
R6004:Rp1	UTSW	1	4197585	missense	unknown
R6018:Rp1	UTSW	1	4352836	missense	possibly damaging	0.83
R6074:Rp1	UTSW	1	4345379	missense	probably benign	0.02
R6127:Rp1	UTSW	1	4349311	missense	possibly damaging	0.80
R6187:Rp1	UTSW	1	4349869	missense	probably damaging	1.00
R6301:Rp1	UTSW	1	4347254	missense	probably benign	0.04
R6317:Rp1	UTSW	1	4041989	missense	unknown
R6405:Rp1	UTSW	1	4345771	missense	probably damaging	1.00
R6445:Rp1	UTSW	1	4226617	missense	unknown
R6466:Rp1	UTSW	1	4347886	missense	probably benign	0.01
R6501:Rp1	UTSW	1	4311280	intron	probably benign
R6547:Rp1	UTSW	1	4170305	missense	unknown
R6604:Rp1	UTSW	1	4019128	missense	unknown
R6700:Rp1	UTSW	1	4349896	missense	probably damaging	1.00
R6706:Rp1	UTSW	1	4142664	missense	unknown
R6831:Rp1	UTSW	1	4349864	splice site	probably null
R6918:Rp1	UTSW	1	3999608	missense	unknown
R6973:Rp1	UTSW	1	4351994	nonsense	probably null
R6981:Rp1	UTSW	1	4345655	missense	probably benign	0.06
R7009:Rp1	UTSW	1	4042068	missense	unknown
R7078:Rp1	UTSW	1	4206791	missense	unknown
R7112:Rp1	UTSW	1	4349018	missense	probably benign	0.43
R7135:Rp1	UTSW	1	4348168	missense	possibly damaging	0.83
R7165:Rp1	UTSW	1	4349917	missense	probably damaging	0.99
R7199:Rp1	UTSW	1	4347290	missense	possibly damaging	0.73
R7232:Rp1	UTSW	1	4228601	missense	unknown
R7367:Rp1	UTSW	1	4347998	missense	probably benign	0.42
R7484:Rp1	UTSW	1	4345481	missense	probably benign	0.10
R7500:Rp1	UTSW	1	4311278	missense	unknown
R7569:Rp1	UTSW	1	4284840	missense	unknown
R7642:Rp1	UTSW	1	4147831	missense	unknown
R7693:Rp1	UTSW	1	4347403	missense	probably damaging	1.00
R7742:Rp1	UTSW	1	4170234	missense	unknown
R7759:Rp1	UTSW	1	4344884	missense	probably benign
R7784:Rp1	UTSW	1	4142658	missense	unknown
R7816:Rp1	UTSW	1	4347703	missense	probably damaging	0.98
R7866:Rp1	UTSW	1	4347701	missense	probably benign	0.02
R8215:Rp1	UTSW	1	4245095	missense	unknown
R8281:Rp1	UTSW	1	4347916	missense	probably damaging	1.00
R8294:Rp1	UTSW	1	4345997	missense	probably benign	0.09
R8309:Rp1	UTSW	1	4347089	missense	probably benign	0.00
R8311:Rp1	UTSW	1	4348349	missense	probably benign	0.11
R8500:Rp1	UTSW	1	4346590	missense	possibly damaging	0.91
R8559:Rp1	UTSW	1	4349561	missense	probably damaging	1.00
R8672:Rp1	UTSW	1	4348784	missense	possibly damaging	0.55
R8688:Rp1	UTSW	1	4346405	missense	probably benign	0.01
R8792:Rp1	UTSW	1	4024868	missense	unknown
R8859:Rp1	UTSW	1	4349960	missense	probably benign	0.07
R8945:Rp1	UTSW	1	4349594	missense	probably benign	0.42
R8959:Rp1	UTSW	1	4349427	intron	probably benign
R8979:Rp1	UTSW	1	4148714	missense	unknown
R9126:Rp1	UTSW	1	4346913	missense	probably damaging	0.99
R9156:Rp1	UTSW	1	4163938	missense	unknown
R9160:Rp1	UTSW	1	4346497	missense	probably benign	0.00
R9221:Rp1	UTSW	1	4245043	missense	unknown
R9263:Rp1	UTSW	1	4348452	missense	probably benign	0.25
R9263:Rp1	UTSW	1	4348937	missense	probably benign	0.02
R9302:Rp1	UTSW	1	4346566	missense	probably damaging	1.00
R9318:Rp1	UTSW	1	4348265	missense	probably benign	0.09
R9414:Rp1	UTSW	1	4243618	missense	unknown
R9474:Rp1	UTSW	1	4092615	critical splice donor site	probably null
R9478:Rp1	UTSW	1	4347322	missense	probably benign	0.06
R9529:Rp1	UTSW	1	4346224	missense	probably benign
R9572:Rp1	UTSW	1	4348439	missense	probably benign
R9673:Rp1	UTSW	1	4267569	missense	unknown
R9709:Rp1	UTSW	1	4042032	missense	unknown
R9716:Rp1	UTSW	1	4142610	critical splice donor site	probably null
RF003:Rp1	UTSW	1	4344694	missense	probably damaging	0.99
V1662:Rp1	UTSW	1	4349560	missense	probably damaging	1.00
X0012:Rp1	UTSW	1	4347695	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TTATGGAGCGACTACTCAGCCAG -3'
(R):5'- AGGTCTCACCCAAAATGAGTG -3'

Sequencing Primer
(F):5'- CAGCACCTTCTTATTGTGGGAGC -3'
(R):5'- ATGAGTGACACACCTTCTACTAG -3'

Posted On

2014-07-14