Incidental Mutation 'R1919:Astn1'
ID 212798
Institutional Source Beutler Lab
Gene Symbol Astn1
Ensembl Gene ENSMUSG00000026587
Gene Name astrotactin 1
Synonyms
MMRRC Submission 039937-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.100) question?
Stock # R1919 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 158189843-158519351 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 158337541 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 416 (V416I)
Ref Sequence ENSEMBL: ENSMUSP00000141518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046110] [ENSMUST00000170718] [ENSMUST00000193042] [ENSMUST00000194369] [ENSMUST00000195311]
AlphaFold Q61137
Predicted Effect probably damaging
Transcript: ENSMUST00000046110
AA Change: V416I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039711
Gene: ENSMUSG00000026587
AA Change: V416I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 507 1.2e1 SMART
EGF 611 652 2.29e1 SMART
EGF_like 659 708 3.57e1 SMART
MACPF 811 999 1.11e-56 SMART
FN3 1030 1142 5.75e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093595
Predicted Effect probably benign
Transcript: ENSMUST00000170718
AA Change: V416I

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127428
Gene: ENSMUSG00000026587
AA Change: V416I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 507 1.2e1 SMART
EGF 611 652 2.29e1 SMART
EGF_like 659 708 3.57e1 SMART
Blast:MACPF 811 835 3e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192868
Predicted Effect probably damaging
Transcript: ENSMUST00000193042
AA Change: V416I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142322
Gene: ENSMUSG00000026587
AA Change: V416I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 507 1.2e1 SMART
EGF 611 652 2.29e1 SMART
EGF_like 659 708 3.57e1 SMART
MACPF 811 999 1.11e-56 SMART
FN3 1030 1142 5.75e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194369
AA Change: V416I

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142017
Gene: ENSMUSG00000026587
AA Change: V416I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 499 2e-2 SMART
EGF 603 644 1.1e-1 SMART
EGF_like 651 700 1.7e-1 SMART
Blast:MACPF 803 828 2e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000195311
AA Change: V416I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141518
Gene: ENSMUSG00000026587
AA Change: V416I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 499 2e-2 SMART
EGF 603 644 1.1e-1 SMART
EGF_like 651 700 1.7e-1 SMART
MACPF 803 991 6.2e-59 SMART
FN3 1022 1134 2.8e-4 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Astrotactin is a neuronal adhesion molecule required for glial-guided migration of young postmitotic neuroblasts in cortical regions of developing brain, including cerebrum, hippocampus, cerebellum, and olfactory bulb (Fink et al., 1995).[supplied by OMIM, Jun 2009]
PHENOTYPE: Homozygous mutation of this gene results in reduced cerebellum size, abnormal Purkinje cell morphology, and reduced coordination performance on the Rotarod test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 137,773,031 (GRCm39) E740G probably damaging Het
4930474N05Rik G T 14: 35,817,414 (GRCm39) V105F possibly damaging Het
Actr10 A G 12: 70,989,104 (GRCm39) I74M probably benign Het
Aen T C 7: 78,555,660 (GRCm39) Y108H probably damaging Het
Afm A T 5: 90,672,779 (GRCm39) K205* probably null Het
Ankrd27 T A 7: 35,332,410 (GRCm39) S846T probably benign Het
Ano3 A G 2: 110,715,352 (GRCm39) S29P probably benign Het
Apaf1 C T 10: 90,913,476 (GRCm39) W138* probably null Het
Arfgef1 C T 1: 10,270,103 (GRCm39) A349T probably benign Het
Arhgef4 A G 1: 34,850,221 (GRCm39) Q1798R probably damaging Het
Atxn2l G A 7: 126,092,340 (GRCm39) T70I probably damaging Het
Auh G A 13: 52,989,532 (GRCm39) P308L probably benign Het
Bltp1 A G 3: 37,061,132 (GRCm39) probably null Het
Bspry T A 4: 62,413,034 (GRCm39) C256S probably damaging Het
C3 C A 17: 57,527,135 (GRCm39) W771C probably damaging Het
Camkv A G 9: 107,824,287 (GRCm39) D233G possibly damaging Het
Catsperd T A 17: 56,942,548 (GRCm39) V109E probably damaging Het
Cd101 A G 3: 100,926,233 (GRCm39) L162P probably damaging Het
Cdr2l A G 11: 115,283,603 (GRCm39) T154A probably damaging Het
Clca3a2 G C 3: 144,516,457 (GRCm39) Q380E probably benign Het
Col6a3 T C 1: 90,750,081 (GRCm39) N251S possibly damaging Het
Cttnbp2nl A G 3: 104,918,594 (GRCm39) V82A possibly damaging Het
Cux1 G A 5: 136,392,173 (GRCm39) Q194* probably null Het
Daam2 T C 17: 49,792,485 (GRCm39) E361G probably benign Het
Dcaf17 A T 2: 70,908,516 (GRCm39) probably null Het
Dnai1 T C 4: 41,570,020 (GRCm39) probably null Het
Eml5 T C 12: 98,765,098 (GRCm39) Y1617C probably damaging Het
Epb41l4b T C 4: 57,040,993 (GRCm39) E490G probably damaging Het
Epha7 T C 4: 28,963,969 (GRCm39) M988T possibly damaging Het
Fancm T C 12: 65,152,294 (GRCm39) C917R possibly damaging Het
Fnip1 C T 11: 54,371,510 (GRCm39) T177I probably damaging Het
Gm3604 G T 13: 62,517,756 (GRCm39) H201N probably benign Het
Gnpda1 T C 18: 38,466,243 (GRCm39) probably null Het
Gpatch8 A G 11: 102,398,968 (GRCm39) probably null Het
H2-M3 T C 17: 37,582,080 (GRCm39) Y179H possibly damaging Het
H2-Q10 C A 17: 35,781,385 (GRCm39) S62R probably damaging Het
Hipk2 G A 6: 38,795,919 (GRCm39) R117* probably null Het
Hrg A T 16: 22,773,207 (GRCm39) Q113H probably damaging Het
Kcnj16 T C 11: 110,915,779 (GRCm39) V147A possibly damaging Het
Kif1a T C 1: 92,946,753 (GRCm39) I1650V possibly damaging Het
Kmt2a C T 9: 44,731,642 (GRCm39) probably benign Het
Krt90 A T 15: 101,465,665 (GRCm39) Y319N probably damaging Het
Lipo4 T C 19: 33,476,671 (GRCm39) N359S possibly damaging Het
Lrp1b G T 2: 41,618,741 (GRCm39) T225K probably benign Het
Map1a C T 2: 121,137,493 (GRCm39) P2532S probably damaging Het
Mmrn2 A G 14: 34,119,600 (GRCm39) D193G probably benign Het
Mpped2 T A 2: 106,697,377 (GRCm39) I284N probably damaging Het
Msh6 A G 17: 88,292,553 (GRCm39) H436R probably benign Het
Mterf3 A T 13: 67,078,126 (GRCm39) S48T probably damaging Het
Muc5b T C 7: 141,399,768 (GRCm39) F414L unknown Het
Mylk4 A T 13: 32,908,836 (GRCm39) D90E probably benign Het
Nherf4 T C 9: 44,161,600 (GRCm39) D93G possibly damaging Het
Nploc4 A G 11: 120,295,055 (GRCm39) Y420H probably damaging Het
Npr2 T A 4: 43,640,578 (GRCm39) Y344N probably damaging Het
Nsun5 A G 5: 135,404,452 (GRCm39) T397A probably benign Het
Ntsr2 A T 12: 16,704,111 (GRCm39) Q204L probably damaging Het
Nwd2 T A 5: 63,963,523 (GRCm39) Y1036N probably damaging Het
Oacyl T C 18: 65,843,618 (GRCm39) V105A possibly damaging Het
Or6c2 T A 10: 129,362,918 (GRCm39) V274D probably damaging Het
Parp3 T A 9: 106,352,316 (GRCm39) Q70L possibly damaging Het
Parp4 T C 14: 56,861,474 (GRCm39) S936P probably damaging Het
Phkb A G 8: 86,648,790 (GRCm39) E202G probably benign Het
Pink1 T C 4: 138,041,331 (GRCm39) N530S probably benign Het
Pou3f2 T C 4: 22,487,119 (GRCm39) D338G probably damaging Het
Prss8 G T 7: 127,529,030 (GRCm39) L9I probably benign Het
Ptpn22 G A 3: 103,784,054 (GRCm39) probably null Het
Rad54b A C 4: 11,601,693 (GRCm39) N416T probably damaging Het
Rasef A G 4: 73,662,351 (GRCm39) S200P possibly damaging Het
Rb1 T A 14: 73,450,430 (GRCm39) K645* probably null Het
Robo2 C T 16: 73,696,042 (GRCm39) G1367D probably benign Het
Rp1 A G 1: 4,422,894 (GRCm39) V52A probably damaging Het
Samd13 T C 3: 146,368,467 (GRCm39) T23A probably benign Het
Scn7a T C 2: 66,530,317 (GRCm39) H676R probably damaging Het
Serpinb6b A G 13: 33,162,223 (GRCm39) I222V probably benign Het
Slc2a8 T C 2: 32,870,091 (GRCm39) Y150C probably damaging Het
Slc7a6os C A 8: 106,937,196 (GRCm39) R88L probably damaging Het
Slc8a2 A G 7: 15,886,845 (GRCm39) I657V probably benign Het
Slit2 C A 5: 48,348,358 (GRCm39) probably benign Het
Spire2 A G 8: 124,089,810 (GRCm39) D447G probably benign Het
Sptlc3 A G 2: 139,408,595 (GRCm39) N237D possibly damaging Het
Stk3 G A 15: 35,073,363 (GRCm39) T119I probably damaging Het
Suv39h2 G A 2: 3,465,353 (GRCm39) T334I probably damaging Het
Syt5 G T 7: 4,543,278 (GRCm39) T327N probably damaging Het
Tcof1 T C 18: 60,949,156 (GRCm39) D1253G possibly damaging Het
Timd5 A G 11: 46,419,358 (GRCm39) D58G possibly damaging Het
Tnks A T 8: 35,342,386 (GRCm39) V388D probably damaging Het
Ugt2b1 T C 5: 87,073,859 (GRCm39) T167A probably benign Het
Usp40 G A 1: 87,923,564 (GRCm39) R236C possibly damaging Het
Utrn T C 10: 12,331,224 (GRCm39) D2904G probably benign Het
Vmn1r226 T C 17: 20,907,842 (GRCm39) S25P probably damaging Het
Vmn2r23 T C 6: 123,689,969 (GRCm39) S282P possibly damaging Het
Vps45 T C 3: 95,953,752 (GRCm39) E200G probably benign Het
Wnt7b T A 15: 85,443,281 (GRCm39) I41F probably damaging Het
Zmym6 T A 4: 126,997,207 (GRCm39) N275K probably damaging Het
Other mutations in Astn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Astn1 APN 1 158,427,889 (GRCm39) missense possibly damaging 0.71
IGL01705:Astn1 APN 1 158,331,883 (GRCm39) missense probably damaging 1.00
IGL01790:Astn1 APN 1 158,407,897 (GRCm39) missense possibly damaging 0.70
IGL01962:Astn1 APN 1 158,496,201 (GRCm39) missense probably damaging 1.00
IGL02000:Astn1 APN 1 158,502,184 (GRCm39) missense probably damaging 1.00
IGL02119:Astn1 APN 1 158,338,724 (GRCm39) intron probably benign
IGL02168:Astn1 APN 1 158,436,911 (GRCm39) missense possibly damaging 0.93
IGL02239:Astn1 APN 1 158,491,700 (GRCm39) critical splice donor site probably null
IGL02271:Astn1 APN 1 158,338,520 (GRCm39) splice site probably benign
IGL02307:Astn1 APN 1 158,502,184 (GRCm39) missense probably damaging 1.00
IGL02504:Astn1 APN 1 158,329,978 (GRCm39) missense probably damaging 1.00
IGL02552:Astn1 APN 1 158,332,965 (GRCm39) missense possibly damaging 0.90
IGL02903:Astn1 APN 1 158,516,120 (GRCm39) missense probably damaging 0.99
IGL03003:Astn1 APN 1 158,439,965 (GRCm39) missense probably benign 0.00
IGL03007:Astn1 APN 1 158,496,193 (GRCm39) splice site probably benign
IGL03354:Astn1 APN 1 158,516,174 (GRCm39) missense probably damaging 1.00
PIT4366001:Astn1 UTSW 1 158,424,781 (GRCm39) missense probably benign 0.23
PIT4366001:Astn1 UTSW 1 158,424,779 (GRCm39) missense probably benign 0.20
R0024:Astn1 UTSW 1 158,511,785 (GRCm39) missense probably damaging 0.99
R0050:Astn1 UTSW 1 158,407,294 (GRCm39) splice site probably benign
R0099:Astn1 UTSW 1 158,329,721 (GRCm39) missense probably damaging 1.00
R0109:Astn1 UTSW 1 158,491,674 (GRCm39) missense possibly damaging 0.79
R0109:Astn1 UTSW 1 158,491,674 (GRCm39) missense possibly damaging 0.79
R0365:Astn1 UTSW 1 158,516,118 (GRCm39) missense probably damaging 1.00
R0416:Astn1 UTSW 1 158,337,461 (GRCm39) missense probably damaging 1.00
R0531:Astn1 UTSW 1 158,427,959 (GRCm39) missense probably damaging 0.99
R0735:Astn1 UTSW 1 158,299,959 (GRCm39) missense possibly damaging 0.53
R0763:Astn1 UTSW 1 158,337,460 (GRCm39) missense possibly damaging 0.93
R0899:Astn1 UTSW 1 158,338,679 (GRCm39) nonsense probably null
R1027:Astn1 UTSW 1 158,407,849 (GRCm39) missense probably damaging 1.00
R1160:Astn1 UTSW 1 158,427,935 (GRCm39) missense possibly damaging 0.83
R1474:Astn1 UTSW 1 158,329,923 (GRCm39) missense probably damaging 1.00
R1517:Astn1 UTSW 1 158,407,146 (GRCm39) splice site probably benign
R1701:Astn1 UTSW 1 158,331,877 (GRCm39) missense possibly damaging 0.54
R1764:Astn1 UTSW 1 158,331,821 (GRCm39) missense probably benign 0.35
R1860:Astn1 UTSW 1 158,429,515 (GRCm39) missense probably damaging 1.00
R1889:Astn1 UTSW 1 158,332,886 (GRCm39) splice site probably null
R2001:Astn1 UTSW 1 158,348,091 (GRCm39) missense probably damaging 1.00
R2007:Astn1 UTSW 1 158,436,875 (GRCm39) missense probably damaging 0.97
R2038:Astn1 UTSW 1 158,484,690 (GRCm39) missense probably benign 0.29
R2044:Astn1 UTSW 1 158,428,072 (GRCm39) missense possibly damaging 0.53
R2084:Astn1 UTSW 1 158,299,978 (GRCm39) missense probably damaging 0.99
R2094:Astn1 UTSW 1 158,495,179 (GRCm39) missense probably benign 0.02
R2163:Astn1 UTSW 1 158,329,720 (GRCm39) missense probably damaging 0.99
R2211:Astn1 UTSW 1 158,484,876 (GRCm39) missense probably benign 0.40
R2268:Astn1 UTSW 1 158,329,669 (GRCm39) missense probably damaging 1.00
R2269:Astn1 UTSW 1 158,329,669 (GRCm39) missense probably damaging 1.00
R2425:Astn1 UTSW 1 158,407,236 (GRCm39) missense probably damaging 0.99
R2428:Astn1 UTSW 1 158,439,916 (GRCm39) missense possibly damaging 0.66
R2980:Astn1 UTSW 1 158,400,521 (GRCm39) critical splice acceptor site probably null
R3713:Astn1 UTSW 1 158,495,102 (GRCm39) missense possibly damaging 0.83
R3745:Astn1 UTSW 1 158,329,630 (GRCm39) missense probably damaging 1.00
R3926:Astn1 UTSW 1 158,407,227 (GRCm39) missense possibly damaging 0.95
R4345:Astn1 UTSW 1 158,329,602 (GRCm39) splice site probably null
R4625:Astn1 UTSW 1 158,407,864 (GRCm39) missense probably damaging 1.00
R4627:Astn1 UTSW 1 158,329,821 (GRCm39) missense possibly damaging 0.55
R4970:Astn1 UTSW 1 158,484,763 (GRCm39) missense possibly damaging 0.88
R5112:Astn1 UTSW 1 158,484,763 (GRCm39) missense possibly damaging 0.88
R5257:Astn1 UTSW 1 158,440,102 (GRCm39) missense probably damaging 1.00
R5292:Astn1 UTSW 1 158,407,933 (GRCm39) critical splice donor site probably null
R5889:Astn1 UTSW 1 158,427,950 (GRCm39) missense possibly damaging 0.93
R5909:Astn1 UTSW 1 158,429,507 (GRCm39) missense probably damaging 1.00
R6020:Astn1 UTSW 1 158,337,563 (GRCm39) missense probably damaging 1.00
R6349:Astn1 UTSW 1 158,491,691 (GRCm39) nonsense probably null
R6481:Astn1 UTSW 1 158,440,032 (GRCm39) missense probably benign 0.29
R6736:Astn1 UTSW 1 158,338,718 (GRCm39) critical splice donor site probably null
R6833:Astn1 UTSW 1 158,491,692 (GRCm39) missense probably benign 0.40
R6834:Astn1 UTSW 1 158,491,692 (GRCm39) missense probably benign 0.40
R6860:Astn1 UTSW 1 158,440,042 (GRCm39) missense probably damaging 1.00
R6874:Astn1 UTSW 1 158,491,644 (GRCm39) nonsense probably null
R7062:Astn1 UTSW 1 158,516,081 (GRCm39) critical splice acceptor site probably null
R7133:Astn1 UTSW 1 158,400,557 (GRCm39) missense probably damaging 1.00
R7355:Astn1 UTSW 1 158,491,846 (GRCm39) splice site probably null
R7402:Astn1 UTSW 1 158,380,425 (GRCm39) intron probably benign
R7412:Astn1 UTSW 1 158,329,919 (GRCm39) missense probably damaging 0.98
R7487:Astn1 UTSW 1 158,438,352 (GRCm39) splice site probably null
R7537:Astn1 UTSW 1 158,495,208 (GRCm39) splice site probably null
R7537:Astn1 UTSW 1 158,332,956 (GRCm39) missense possibly damaging 0.84
R7635:Astn1 UTSW 1 158,495,105 (GRCm39) nonsense probably null
R7890:Astn1 UTSW 1 158,407,903 (GRCm39) missense probably damaging 1.00
R7894:Astn1 UTSW 1 158,429,508 (GRCm39) missense probably damaging 0.98
R7904:Astn1 UTSW 1 158,424,886 (GRCm39) missense probably benign 0.37
R8048:Astn1 UTSW 1 158,516,208 (GRCm39) missense probably benign 0.00
R8061:Astn1 UTSW 1 158,331,920 (GRCm39) critical splice donor site probably null
R8096:Astn1 UTSW 1 158,436,890 (GRCm39) missense probably damaging 1.00
R8327:Astn1 UTSW 1 158,436,850 (GRCm39) missense probably damaging 1.00
R8374:Astn1 UTSW 1 158,329,803 (GRCm39) missense probably damaging 1.00
R8400:Astn1 UTSW 1 158,484,670 (GRCm39) missense probably benign 0.09
R8983:Astn1 UTSW 1 158,491,700 (GRCm39) critical splice donor site probably null
R9013:Astn1 UTSW 1 158,348,070 (GRCm39) missense probably damaging 1.00
R9110:Astn1 UTSW 1 158,496,327 (GRCm39) missense probably benign 0.01
R9156:Astn1 UTSW 1 158,338,555 (GRCm39) missense probably damaging 0.99
R9355:Astn1 UTSW 1 158,511,721 (GRCm39) missense probably damaging 1.00
R9683:Astn1 UTSW 1 158,491,619 (GRCm39) missense possibly damaging 0.93
Z1088:Astn1 UTSW 1 158,511,666 (GRCm39) nonsense probably null
Z1088:Astn1 UTSW 1 158,424,776 (GRCm39) missense possibly damaging 0.91
Z1088:Astn1 UTSW 1 158,300,067 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCTGTTTGCTGGCAGAAGGC -3'
(R):5'- GAGTATTGGAGATGACCTGTCAC -3'

Sequencing Primer
(F):5'- CAGAAGGCCGAGTCATCTG -3'
(R):5'- CTGCAAACATCTGTGTACAATCTAGC -3'
Posted On 2014-07-14