Mutagenetix > Incidental Mutation

Incidental Mutation 'R1919:Ano3'

212806

Institutional Source

Beutler Lab

Gene Symbol

Ano3

Ensembl Gene

ENSMUSG00000074968

Gene Name

anoctamin 3

Synonyms

Tmem16c, B230324K02Rik

MMRRC Submission

039937-MU

Accession Numbers

Genbank: NM_001081556, NM_001128103; MGI: 3613666

Essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R1919 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110655201-110950923 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 110885007 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 29 (S29P)

Ref Sequence

ENSEMBL: ENSMUSP00000097219 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099623]

AlphaFold

A2AHL1

Predicted Effect

probably benign
Transcript: ENSMUST00000099623
AA Change: S29P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968
AA Change: S29P

Domain	Start	End	E-Value	Type
Pfam:Anoct_dimer	156	381	2.9e-70	PFAM
Pfam:Anoctamin	384	950	4.4e-138	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000111019

SMART Domains

Protein: ENSMUSP00000106648
Gene: ENSMUSG00000074968

Domain	Start	End	E-Value	Type
Pfam:Anoctamin	384	627	6.3e-60	PFAM

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.7%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TMEM16 family of predicted membrane proteins, that are also known as anoctamins. While little is known about the function of this gene, mutations in this gene have been associated with some cases of autosomal dominant craniocervical dystonia. Cells from individuals with a mutation in this gene exhibited abnormalities in endoplasmic reticulum-dependent calcium signaling. Studies in rat show that the rat ortholog of this protein interacts with, and modulates the activity of a sodium-activated potassium channel. Deletion of this gene caused increased pain sensitivity in the rat model system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,067,270	E740G	probably damaging	Het
4930474N05Rik	G	T	14: 36,095,457	V105F	possibly damaging	Het
4932438A13Rik	A	G	3: 37,006,983		probably null	Het
Actr10	A	G	12: 70,942,330	I74M	probably benign	Het
Aen	T	C	7: 78,905,912	Y108H	probably damaging	Het
Afm	A	T	5: 90,524,920	K205*	probably null	Het
Ankrd27	T	A	7: 35,632,985	S846T	probably benign	Het
Apaf1	C	T	10: 91,077,614	W138*	probably null	Het
Arfgef1	C	T	1: 10,199,878	A349T	probably benign	Het
Arhgef4	A	G	1: 34,811,140	Q1798R	probably damaging	Het
Astn1	G	A	1: 158,509,971	V416I	probably damaging	Het
Atxn2l	G	A	7: 126,493,168	T70I	probably damaging	Het
Auh	G	A	13: 52,835,496	P308L	probably benign	Het
Bspry	T	A	4: 62,494,797	C256S	probably damaging	Het
C3	C	A	17: 57,220,135	W771C	probably damaging	Het
Camkv	A	G	9: 107,947,088	D233G	possibly damaging	Het
Catsperd	T	A	17: 56,635,548	V109E	probably damaging	Het
Cd101	A	G	3: 101,018,917	L162P	probably damaging	Het
Cdr2l	A	G	11: 115,392,777	T154A	probably damaging	Het
Clca3a2	G	C	3: 144,810,696	Q380E	probably benign	Het
Col6a3	T	C	1: 90,822,359	N251S	possibly damaging	Het
Cttnbp2nl	A	G	3: 105,011,278	V82A	possibly damaging	Het
Cux1	G	A	5: 136,363,319	Q194*	probably null	Het
Daam2	T	C	17: 49,485,457	E361G	probably benign	Het
Dcaf17	A	T	2: 71,078,172		probably null	Het
Dnaic1	T	C	4: 41,570,020		probably null	Het
Eml5	T	C	12: 98,798,839	Y1617C	probably damaging	Het
Epb41l4b	T	C	4: 57,040,993	E490G	probably damaging	Het
Epha7	T	C	4: 28,963,969	M988T	possibly damaging	Het
Fancm	T	C	12: 65,105,520	C917R	possibly damaging	Het
Fnip1	C	T	11: 54,480,684	T177I	probably damaging	Het
Gm12169	A	G	11: 46,528,531	D58G	possibly damaging	Het
Gm3604	G	T	13: 62,369,942	H201N	probably benign	Het
Gnpda1	T	C	18: 38,333,190		probably null	Het
Gpatch8	A	G	11: 102,508,142		probably null	Het
H2-M3	T	C	17: 37,271,189	Y179H	possibly damaging	Het
H2-Q10	C	A	17: 35,470,488	S62R	probably damaging	Het
Hipk2	G	A	6: 38,818,984	R117*	probably null	Het
Hrg	A	T	16: 22,954,457	Q113H	probably damaging	Het
Kcnj16	T	C	11: 111,024,953	V147A	possibly damaging	Het
Kif1a	T	C	1: 93,019,031	I1650V	possibly damaging	Het
Kmt2a	C	T	9: 44,820,345		probably benign	Het
Krt90	A	T	15: 101,557,230	Y319N	probably damaging	Het
Lipo4	T	C	19: 33,499,271	N359S	possibly damaging	Het
Lrp1b	G	T	2: 41,728,729	T225K	probably benign	Het
Map1a	C	T	2: 121,307,012	P2532S	probably damaging	Het
Mmrn2	A	G	14: 34,397,643	D193G	probably benign	Het
Mpped2	T	A	2: 106,867,032	I284N	probably damaging	Het
Msh6	A	G	17: 87,985,125	H436R	probably benign	Het
Mterf3	A	T	13: 66,930,062	S48T	probably damaging	Het
Muc5b	T	C	7: 141,846,031	F414L	unknown	Het
Mylk4	A	T	13: 32,724,853	D90E	probably benign	Het
Nploc4	A	G	11: 120,404,229	Y420H	probably damaging	Het
Npr2	T	A	4: 43,640,578	Y344N	probably damaging	Het
Nsun5	A	G	5: 135,375,598	T397A	probably benign	Het
Ntsr2	A	T	12: 16,654,110	Q204L	probably damaging	Het
Nwd2	T	A	5: 63,806,180	Y1036N	probably damaging	Het
Oacyl	T	C	18: 65,710,547	V105A	possibly damaging	Het
Olfr791	T	A	10: 129,527,049	V274D	probably damaging	Het
Parp3	T	A	9: 106,475,117	Q70L	possibly damaging	Het
Parp4	T	C	14: 56,624,017	S936P	probably damaging	Het
Pdzd3	T	C	9: 44,250,303	D93G	possibly damaging	Het
Phkb	A	G	8: 85,922,161	E202G	probably benign	Het
Pink1	T	C	4: 138,314,020	N530S	probably benign	Het
Pou3f2	T	C	4: 22,487,119	D338G	probably damaging	Het
Prss8	G	T	7: 127,929,858	L9I	probably benign	Het
Ptpn22	G	A	3: 103,876,738		probably null	Het
Rad54b	A	C	4: 11,601,693	N416T	probably damaging	Het
Rasef	A	G	4: 73,744,114	S200P	possibly damaging	Het
Rb1	T	A	14: 73,212,990	K645*	probably null	Het
Robo2	C	T	16: 73,899,154	G1367D	probably benign	Het
Rp1	A	G	1: 4,352,671	V52A	probably damaging	Het
Samd13	T	C	3: 146,662,712	T23A	probably benign	Het
Scn7a	T	C	2: 66,699,973	H676R	probably damaging	Het
Serpinb6b	A	G	13: 32,978,240	I222V	probably benign	Het
Slc2a8	T	C	2: 32,980,079	Y150C	probably damaging	Het
Slc7a6os	C	A	8: 106,210,564	R88L	probably damaging	Het
Slc8a2	A	G	7: 16,152,920	I657V	probably benign	Het
Slit2	C	A	5: 48,191,016		probably benign	Het
Spire2	A	G	8: 123,363,071	D447G	probably benign	Het
Sptlc3	A	G	2: 139,566,675	N237D	possibly damaging	Het
Stk3	G	A	15: 35,073,217	T119I	probably damaging	Het
Suv39h2	G	A	2: 3,464,316	T334I	probably damaging	Het
Syt5	G	T	7: 4,540,279	T327N	probably damaging	Het
Tcof1	T	C	18: 60,816,084	D1253G	possibly damaging	Het
Tnks	A	T	8: 34,875,232	V388D	probably damaging	Het
Ugt2b1	T	C	5: 86,926,000	T167A	probably benign	Het
Usp40	G	A	1: 87,995,842	R236C	possibly damaging	Het
Utrn	T	C	10: 12,455,480	D2904G	probably benign	Het
Vmn1r226	T	C	17: 20,687,580	S25P	probably damaging	Het
Vmn2r23	T	C	6: 123,713,010	S282P	possibly damaging	Het
Vps45	T	C	3: 96,046,440	E200G	probably benign	Het
Wnt7b	T	A	15: 85,559,080	I41F	probably damaging	Het
Zmym6	T	A	4: 127,103,414	N275K	probably damaging	Het

Other mutations in Ano3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Ano3	APN	2	110771050	splice site	probably benign
IGL01066:Ano3	APN	2	110661445	missense	probably null	0.00
IGL01696:Ano3	APN	2	110667737	missense	probably damaging	1.00
IGL01729:Ano3	APN	2	110781394	splice site	probably null
IGL01785:Ano3	APN	2	110682715	missense	probably damaging	1.00
IGL01786:Ano3	APN	2	110682715	missense	probably damaging	1.00
IGL01992:Ano3	APN	2	110658219	missense	probably damaging	1.00
IGL02098:Ano3	APN	2	110666441	nonsense	probably null
IGL02333:Ano3	APN	2	110697199	splice site	probably benign
IGL02346:Ano3	APN	2	110770926	splice site	probably benign
IGL02352:Ano3	APN	2	110884943	nonsense	probably null
IGL02359:Ano3	APN	2	110884943	nonsense	probably null
IGL02544:Ano3	APN	2	110658249	missense	possibly damaging	0.79
IGL02750:Ano3	APN	2	110665984	splice site	probably benign
IGL02861:Ano3	APN	2	110738812	missense	probably damaging	1.00
IGL02948:Ano3	APN	2	110697018	splice site	probably benign
IGL03327:Ano3	APN	2	110697178	missense	possibly damaging	0.62
3-1:Ano3	UTSW	2	110697124	missense	probably damaging	1.00
IGL02988:Ano3	UTSW	2	110775010	missense	probably damaging	1.00
IGL03147:Ano3	UTSW	2	110697418	missense	probably damaging	1.00
R0349:Ano3	UTSW	2	110661487	missense	probably damaging	1.00
R0426:Ano3	UTSW	2	110661174	missense	probably damaging	1.00
R0523:Ano3	UTSW	2	110884855	missense	probably benign	0.13
R0557:Ano3	UTSW	2	110862952	splice site	probably null
R0611:Ano3	UTSW	2	110885001	missense	possibly damaging	0.93
R0891:Ano3	UTSW	2	110697976	missense	probably benign	0.03
R1459:Ano3	UTSW	2	110880829	missense	probably benign	0.00
R1460:Ano3	UTSW	2	110682758	missense	probably damaging	0.97
R1773:Ano3	UTSW	2	110761455	missense	probably damaging	1.00
R1874:Ano3	UTSW	2	110884872	missense	probably benign	0.00
R2185:Ano3	UTSW	2	110775045	missense	probably benign	0.01
R2280:Ano3	UTSW	2	110682759	missense	probably benign	0.22
R2281:Ano3	UTSW	2	110682759	missense	probably benign	0.22
R2348:Ano3	UTSW	2	110783743	missense	possibly damaging	0.82
R2425:Ano3	UTSW	2	110862843	missense	probably benign
R2697:Ano3	UTSW	2	110794960	missense	possibly damaging	0.79
R3888:Ano3	UTSW	2	110885000	missense	probably damaging	0.99
R3923:Ano3	UTSW	2	110770959	missense	probably damaging	1.00
R4352:Ano3	UTSW	2	110745894	missense	possibly damaging	0.74
R4447:Ano3	UTSW	2	110761578	splice site	probably null
R4790:Ano3	UTSW	2	110884919	missense	probably benign
R4832:Ano3	UTSW	2	110667722	missense	probably damaging	1.00
R4916:Ano3	UTSW	2	110771020	missense	possibly damaging	0.74
R5113:Ano3	UTSW	2	110661480	missense	possibly damaging	0.61
R5486:Ano3	UTSW	2	110745870	missense	probably damaging	1.00
R5498:Ano3	UTSW	2	110697103	missense	possibly damaging	0.68
R5589:Ano3	UTSW	2	110884995	missense	probably damaging	0.99
R5627:Ano3	UTSW	2	110756953	missense	possibly damaging	0.61
R5741:Ano3	UTSW	2	110658273	missense	probably benign	0.11
R5767:Ano3	UTSW	2	110661271	missense	probably damaging	1.00
R5883:Ano3	UTSW	2	110880864	missense	probably null	0.15
R5899:Ano3	UTSW	2	110862887	missense	probably benign	0.39
R5916:Ano3	UTSW	2	110681836	missense	probably benign	0.29
R6158:Ano3	UTSW	2	110665875	missense	probably damaging	1.00
R6315:Ano3	UTSW	2	110697039	missense	probably damaging	1.00
R6401:Ano3	UTSW	2	110775114	missense	probably benign	0.01
R6481:Ano3	UTSW	2	110795027	missense	probably benign	0.16
R6482:Ano3	UTSW	2	110697055	missense	probably damaging	1.00
R6587:Ano3	UTSW	2	110797904	splice site	probably null
R6811:Ano3	UTSW	2	110880867	missense	probably benign	0.03
R7048:Ano3	UTSW	2	110682771	nonsense	probably null
R7145:Ano3	UTSW	2	110862860	missense	probably benign	0.31
R7207:Ano3	UTSW	2	110781423	missense	probably damaging	0.96
R7215:Ano3	UTSW	2	110665932	missense	probably damaging	1.00
R7366:Ano3	UTSW	2	110757067	missense	probably damaging	1.00
R7371:Ano3	UTSW	2	110884849	critical splice donor site	probably null
R7568:Ano3	UTSW	2	110950293	start gained	probably benign
R7636:Ano3	UTSW	2	110682703	nonsense	probably null
R7888:Ano3	UTSW	2	110666428	missense	probably damaging	1.00
R7992:Ano3	UTSW	2	110775022	missense	possibly damaging	0.77
R8024:Ano3	UTSW	2	110667783	missense	probably damaging	0.99
R8074:Ano3	UTSW	2	110950232	start gained	probably benign
R8111:Ano3	UTSW	2	110783713	missense	possibly damaging	0.95
R8177:Ano3	UTSW	2	110666456	missense	probably damaging	1.00
R8297:Ano3	UTSW	2	110661271	missense	probably damaging	1.00
R8485:Ano3	UTSW	2	110667855	critical splice acceptor site	probably null
R8509:Ano3	UTSW	2	110665835	missense	possibly damaging	0.50
R8870:Ano3	UTSW	2	110783729	missense	probably benign	0.12
R9071:Ano3	UTSW	2	110795073	critical splice acceptor site	probably null
R9072:Ano3	UTSW	2	110745898	missense	probably benign	0.06
R9073:Ano3	UTSW	2	110745898	missense	probably benign	0.06
R9315:Ano3	UTSW	2	110697942	missense	probably damaging	0.97
R9376:Ano3	UTSW	2	110666437	missense	probably damaging	1.00
R9588:Ano3	UTSW	2	110697997	missense	possibly damaging	0.91
R9697:Ano3	UTSW	2	110665908	missense	probably damaging	1.00
R9716:Ano3	UTSW	2	110771031	missense	probably damaging	0.97
R9748:Ano3	UTSW	2	110658295	missense	probably damaging	1.00
RF012:Ano3	UTSW	2	110697523	missense	possibly damaging	0.83
RF013:Ano3	UTSW	2	110697036	missense	probably benign	0.30
X0058:Ano3	UTSW	2	110697418	missense	probably damaging	1.00
Z1088:Ano3	UTSW	2	110745847	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGTCACATACCATGTTCAGG -3'
(R):5'- ATGTTCAGCATTATTGTCCATCAGG -3'

Sequencing Primer
(F):5'- CACATACCATGTTCAGGCTTATCAG -3'
(R):5'- GCATTTGTTGGTCTCTGAC -3'

Posted On

2014-07-14