Incidental Mutation 'R1919:Ano3'
ID212806
Institutional Source Beutler Lab
Gene Symbol Ano3
Ensembl Gene ENSMUSG00000074968
Gene Nameanoctamin 3
SynonymsTmem16c, B230324K02Rik
MMRRC Submission 039937-MU
Accession Numbers

Genbank: NM_001081556, NM_001128103; MGI: 3613666

Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R1919 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location110655201-110950923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110885007 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 29 (S29P)
Ref Sequence ENSEMBL: ENSMUSP00000097219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099623]
Predicted Effect probably benign
Transcript: ENSMUST00000099623
AA Change: S29P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968
AA Change: S29P

DomainStartEndE-ValueType
Pfam:Anoct_dimer 156 381 2.9e-70 PFAM
Pfam:Anoctamin 384 950 4.4e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111019
SMART Domains Protein: ENSMUSP00000106648
Gene: ENSMUSG00000074968

DomainStartEndE-ValueType
Pfam:Anoctamin 384 627 6.3e-60 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TMEM16 family of predicted membrane proteins, that are also known as anoctamins. While little is known about the function of this gene, mutations in this gene have been associated with some cases of autosomal dominant craniocervical dystonia. Cells from individuals with a mutation in this gene exhibited abnormalities in endoplasmic reticulum-dependent calcium signaling. Studies in rat show that the rat ortholog of this protein interacts with, and modulates the activity of a sodium-activated potassium channel. Deletion of this gene caused increased pain sensitivity in the rat model system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,270 E740G probably damaging Het
4930474N05Rik G T 14: 36,095,457 V105F possibly damaging Het
4932438A13Rik A G 3: 37,006,983 probably null Het
Actr10 A G 12: 70,942,330 I74M probably benign Het
Aen T C 7: 78,905,912 Y108H probably damaging Het
Afm A T 5: 90,524,920 K205* probably null Het
Ankrd27 T A 7: 35,632,985 S846T probably benign Het
Apaf1 C T 10: 91,077,614 W138* probably null Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgef4 A G 1: 34,811,140 Q1798R probably damaging Het
Astn1 G A 1: 158,509,971 V416I probably damaging Het
Atxn2l G A 7: 126,493,168 T70I probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bspry T A 4: 62,494,797 C256S probably damaging Het
C3 C A 17: 57,220,135 W771C probably damaging Het
Camkv A G 9: 107,947,088 D233G possibly damaging Het
Catsperd T A 17: 56,635,548 V109E probably damaging Het
Cd101 A G 3: 101,018,917 L162P probably damaging Het
Cdr2l A G 11: 115,392,777 T154A probably damaging Het
Clca3a2 G C 3: 144,810,696 Q380E probably benign Het
Col6a3 T C 1: 90,822,359 N251S possibly damaging Het
Cttnbp2nl A G 3: 105,011,278 V82A possibly damaging Het
Cux1 G A 5: 136,363,319 Q194* probably null Het
Daam2 T C 17: 49,485,457 E361G probably benign Het
Dcaf17 A T 2: 71,078,172 probably null Het
Dnaic1 T C 4: 41,570,020 probably null Het
Eml5 T C 12: 98,798,839 Y1617C probably damaging Het
Epb41l4b T C 4: 57,040,993 E490G probably damaging Het
Epha7 T C 4: 28,963,969 M988T possibly damaging Het
Fancm T C 12: 65,105,520 C917R possibly damaging Het
Fnip1 C T 11: 54,480,684 T177I probably damaging Het
Gm12169 A G 11: 46,528,531 D58G possibly damaging Het
Gm3604 G T 13: 62,369,942 H201N probably benign Het
Gnpda1 T C 18: 38,333,190 probably null Het
Gpatch8 A G 11: 102,508,142 probably null Het
H2-M3 T C 17: 37,271,189 Y179H possibly damaging Het
H2-Q10 C A 17: 35,470,488 S62R probably damaging Het
Hipk2 G A 6: 38,818,984 R117* probably null Het
Hrg A T 16: 22,954,457 Q113H probably damaging Het
Kcnj16 T C 11: 111,024,953 V147A possibly damaging Het
Kif1a T C 1: 93,019,031 I1650V possibly damaging Het
Kmt2a C T 9: 44,820,345 probably benign Het
Krt90 A T 15: 101,557,230 Y319N probably damaging Het
Lipo4 T C 19: 33,499,271 N359S possibly damaging Het
Lrp1b G T 2: 41,728,729 T225K probably benign Het
Map1a C T 2: 121,307,012 P2532S probably damaging Het
Mmrn2 A G 14: 34,397,643 D193G probably benign Het
Mpped2 T A 2: 106,867,032 I284N probably damaging Het
Msh6 A G 17: 87,985,125 H436R probably benign Het
Mterf3 A T 13: 66,930,062 S48T probably damaging Het
Muc5b T C 7: 141,846,031 F414L unknown Het
Mylk4 A T 13: 32,724,853 D90E probably benign Het
Nploc4 A G 11: 120,404,229 Y420H probably damaging Het
Npr2 T A 4: 43,640,578 Y344N probably damaging Het
Nsun5 A G 5: 135,375,598 T397A probably benign Het
Ntsr2 A T 12: 16,654,110 Q204L probably damaging Het
Nwd2 T A 5: 63,806,180 Y1036N probably damaging Het
Oacyl T C 18: 65,710,547 V105A possibly damaging Het
Olfr791 T A 10: 129,527,049 V274D probably damaging Het
Parp3 T A 9: 106,475,117 Q70L possibly damaging Het
Parp4 T C 14: 56,624,017 S936P probably damaging Het
Pdzd3 T C 9: 44,250,303 D93G possibly damaging Het
Phkb A G 8: 85,922,161 E202G probably benign Het
Pink1 T C 4: 138,314,020 N530S probably benign Het
Pou3f2 T C 4: 22,487,119 D338G probably damaging Het
Prss8 G T 7: 127,929,858 L9I probably benign Het
Ptpn22 G A 3: 103,876,738 probably null Het
Rad54b A C 4: 11,601,693 N416T probably damaging Het
Rasef A G 4: 73,744,114 S200P possibly damaging Het
Rb1 T A 14: 73,212,990 K645* probably null Het
Robo2 C T 16: 73,899,154 G1367D probably benign Het
Rp1 A G 1: 4,352,671 V52A probably damaging Het
Samd13 T C 3: 146,662,712 T23A probably benign Het
Scn7a T C 2: 66,699,973 H676R probably damaging Het
Serpinb6b A G 13: 32,978,240 I222V probably benign Het
Slc2a8 T C 2: 32,980,079 Y150C probably damaging Het
Slc7a6os C A 8: 106,210,564 R88L probably damaging Het
Slc8a2 A G 7: 16,152,920 I657V probably benign Het
Slit2 C A 5: 48,191,016 probably benign Het
Spire2 A G 8: 123,363,071 D447G probably benign Het
Sptlc3 A G 2: 139,566,675 N237D possibly damaging Het
Stk3 G A 15: 35,073,217 T119I probably damaging Het
Suv39h2 G A 2: 3,464,316 T334I probably damaging Het
Syt5 G T 7: 4,540,279 T327N probably damaging Het
Tcof1 T C 18: 60,816,084 D1253G possibly damaging Het
Tnks A T 8: 34,875,232 V388D probably damaging Het
Ugt2b1 T C 5: 86,926,000 T167A probably benign Het
Usp40 G A 1: 87,995,842 R236C possibly damaging Het
Utrn T C 10: 12,455,480 D2904G probably benign Het
Vmn1r226 T C 17: 20,687,580 S25P probably damaging Het
Vmn2r23 T C 6: 123,713,010 S282P possibly damaging Het
Vps45 T C 3: 96,046,440 E200G probably benign Het
Wnt7b T A 15: 85,559,080 I41F probably damaging Het
Zmym6 T A 4: 127,103,414 N275K probably damaging Het
Other mutations in Ano3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ano3 APN 2 110771050 splice site probably benign
IGL01066:Ano3 APN 2 110661445 missense probably null 0.00
IGL01696:Ano3 APN 2 110667737 missense probably damaging 1.00
IGL01729:Ano3 APN 2 110781394 splice site probably null
IGL01785:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01786:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01992:Ano3 APN 2 110658219 missense probably damaging 1.00
IGL02098:Ano3 APN 2 110666441 nonsense probably null
IGL02333:Ano3 APN 2 110697199 splice site probably benign
IGL02346:Ano3 APN 2 110770926 splice site probably benign
IGL02352:Ano3 APN 2 110884943 nonsense probably null
IGL02359:Ano3 APN 2 110884943 nonsense probably null
IGL02544:Ano3 APN 2 110658249 missense possibly damaging 0.79
IGL02750:Ano3 APN 2 110665984 splice site probably benign
IGL02861:Ano3 APN 2 110738812 missense probably damaging 1.00
IGL02948:Ano3 APN 2 110697018 splice site probably benign
IGL03327:Ano3 APN 2 110697178 missense possibly damaging 0.62
3-1:Ano3 UTSW 2 110697124 missense probably damaging 1.00
IGL02988:Ano3 UTSW 2 110775010 missense probably damaging 1.00
IGL03147:Ano3 UTSW 2 110697418 missense probably damaging 1.00
R0349:Ano3 UTSW 2 110661487 missense probably damaging 1.00
R0426:Ano3 UTSW 2 110661174 missense probably damaging 1.00
R0523:Ano3 UTSW 2 110884855 missense probably benign 0.13
R0557:Ano3 UTSW 2 110862952 splice site probably null
R0611:Ano3 UTSW 2 110885001 missense possibly damaging 0.93
R0891:Ano3 UTSW 2 110697976 missense probably benign 0.03
R1459:Ano3 UTSW 2 110880829 missense probably benign 0.00
R1460:Ano3 UTSW 2 110682758 missense probably damaging 0.97
R1773:Ano3 UTSW 2 110761455 missense probably damaging 1.00
R1874:Ano3 UTSW 2 110884872 missense probably benign 0.00
R2185:Ano3 UTSW 2 110775045 missense probably benign 0.01
R2280:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2281:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2348:Ano3 UTSW 2 110783743 missense possibly damaging 0.82
R2425:Ano3 UTSW 2 110862843 missense probably benign
R2697:Ano3 UTSW 2 110794960 missense possibly damaging 0.79
R3888:Ano3 UTSW 2 110885000 missense probably damaging 0.99
R3923:Ano3 UTSW 2 110770959 missense probably damaging 1.00
R4352:Ano3 UTSW 2 110745894 missense possibly damaging 0.74
R4447:Ano3 UTSW 2 110761578 unclassified probably null
R4790:Ano3 UTSW 2 110884919 missense probably benign
R4832:Ano3 UTSW 2 110667722 missense probably damaging 1.00
R4916:Ano3 UTSW 2 110771020 missense possibly damaging 0.74
R5113:Ano3 UTSW 2 110661480 missense possibly damaging 0.61
R5486:Ano3 UTSW 2 110745870 missense probably damaging 1.00
R5498:Ano3 UTSW 2 110697103 missense possibly damaging 0.68
R5589:Ano3 UTSW 2 110884995 missense probably damaging 0.99
R5627:Ano3 UTSW 2 110756953 missense possibly damaging 0.61
R5741:Ano3 UTSW 2 110658273 missense probably benign 0.11
R5767:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R5883:Ano3 UTSW 2 110880864 missense probably null 0.15
R5899:Ano3 UTSW 2 110862887 missense probably benign 0.39
R5916:Ano3 UTSW 2 110681836 missense probably benign 0.29
R6158:Ano3 UTSW 2 110665875 missense probably damaging 1.00
R6315:Ano3 UTSW 2 110697039 missense probably damaging 1.00
R6401:Ano3 UTSW 2 110775114 missense probably benign 0.01
R6481:Ano3 UTSW 2 110795027 missense probably benign 0.16
R6482:Ano3 UTSW 2 110697055 missense probably damaging 1.00
R6587:Ano3 UTSW 2 110797904 intron probably null
R6811:Ano3 UTSW 2 110880867 missense probably benign 0.03
R7048:Ano3 UTSW 2 110682771 nonsense probably null
R7145:Ano3 UTSW 2 110862860 missense probably benign 0.31
R7207:Ano3 UTSW 2 110781423 missense probably damaging 0.96
R7215:Ano3 UTSW 2 110665932 missense probably damaging 1.00
R7366:Ano3 UTSW 2 110757067 missense probably damaging 1.00
R7371:Ano3 UTSW 2 110884849 critical splice donor site probably null
R7568:Ano3 UTSW 2 110950293 start gained probably benign
R7636:Ano3 UTSW 2 110682703 nonsense probably null
RF012:Ano3 UTSW 2 110697523 missense possibly damaging 0.83
RF013:Ano3 UTSW 2 110697036 missense probably benign 0.30
X0058:Ano3 UTSW 2 110697418 missense probably damaging 1.00
Z1088:Ano3 UTSW 2 110745847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTCACATACCATGTTCAGG -3'
(R):5'- ATGTTCAGCATTATTGTCCATCAGG -3'

Sequencing Primer
(F):5'- CACATACCATGTTCAGGCTTATCAG -3'
(R):5'- GCATTTGTTGGTCTCTGAC -3'
Posted On2014-07-14