Mutagenetix > Incidental Mutations

Incidental Mutation 'R1919:Map1a'

212808

Institutional Source

Beutler Lab

Gene Symbol

Map1a

Ensembl Gene

ENSMUSG00000027254

Gene Name

microtubule-associated protein 1 A

Synonyms

Mtap1, Mtap-1, 6330416M19Rik, Mtap1a

MMRRC Submission

039937-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.456) question?

Stock #

R1919 (G1)

Quality Score

208

Status

Not validated

Chromosome

Chromosomal Location

121289600-121310832 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 121307012 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 2532 (P2532S)

Ref Sequence

ENSEMBL: ENSMUSP00000106269 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052029] [ENSMUST00000094639] [ENSMUST00000110625] [ENSMUST00000110626] [ENSMUST00000110627] [ENSMUST00000110628] [ENSMUST00000110639]

Predicted Effect

probably benign
Transcript: ENSMUST00000052029

SMART Domains

Protein: ENSMUSP00000057632
Gene: ENSMUSG00000033526

Domain	Start	End	E-Value	Type
low complexity region	35	48	N/A	INTRINSIC
PDB:3T99\|A	50	377	N/A	PDB
Pfam:His_Phos_2	390	906	8.8e-110	PFAM
low complexity region	1163	1181	N/A	INTRINSIC
coiled coil region	1402	1430	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000094639
AA Change: P2770S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000092223
Gene: ENSMUSG00000027254
AA Change: P2770S

Domain	Start	End	E-Value	Type
Blast:Lactamase_B	286	538	2e-54	BLAST
SCOP:d1eq1a_	584	699	8e-5	SMART
low complexity region	743	755	N/A	INTRINSIC
low complexity region	820	833	N/A	INTRINSIC
low complexity region	852	867	N/A	INTRINSIC
low complexity region	897	911	N/A	INTRINSIC
low complexity region	1228	1239	N/A	INTRINSIC
low complexity region	1334	1344	N/A	INTRINSIC
low complexity region	1540	1555	N/A	INTRINSIC
coiled coil region	1573	1602	N/A	INTRINSIC
internal_repeat_1	1616	1726	7.66e-6	PROSPERO
coiled coil region	1747	1771	N/A	INTRINSIC
internal_repeat_1	1774	1888	7.66e-6	PROSPERO
low complexity region	2060	2084	N/A	INTRINSIC
low complexity region	2121	2133	N/A	INTRINSIC
low complexity region	2156	2169	N/A	INTRINSIC
low complexity region	2383	2396	N/A	INTRINSIC
low complexity region	2436	2460	N/A	INTRINSIC
low complexity region	2517	2541	N/A	INTRINSIC
low complexity region	2589	2600	N/A	INTRINSIC
low complexity region	2662	2682	N/A	INTRINSIC
low complexity region	2685	2704	N/A	INTRINSIC
low complexity region	2716	2728	N/A	INTRINSIC
low complexity region	2766	2790	N/A	INTRINSIC
low complexity region	2980	2988	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110625

SMART Domains

Protein: ENSMUSP00000106255
Gene: ENSMUSG00000033526

Domain	Start	End	E-Value	Type
low complexity region	35	48	N/A	INTRINSIC
PDB:3T99\|A	50	377	N/A	PDB
Pfam:His_Phos_2	390	906	8.5e-110	PFAM
low complexity region	1142	1160	N/A	INTRINSIC
coiled coil region	1381	1409	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110626

SMART Domains

Protein: ENSMUSP00000106256
Gene: ENSMUSG00000033526

Domain	Start	End	E-Value	Type
low complexity region	35	48	N/A	INTRINSIC
PDB:3T99\|A	50	377	N/A	PDB
Pfam:His_Phos_2	390	906	1.1e-135	PFAM
low complexity region	1163	1181	N/A	INTRINSIC
coiled coil region	1402	1430	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110627

SMART Domains

Protein: ENSMUSP00000106257
Gene: ENSMUSG00000033526

Domain	Start	End	E-Value	Type
low complexity region	35	48	N/A	INTRINSIC
PDB:3T99\|A	50	377	N/A	PDB
Pfam:His_Phos_2	390	906	8.5e-110	PFAM
low complexity region	1142	1160	N/A	INTRINSIC
coiled coil region	1381	1409	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110628

SMART Domains

Protein: ENSMUSP00000106258
Gene: ENSMUSG00000033526

Domain	Start	End	E-Value	Type
low complexity region	35	48	N/A	INTRINSIC
PDB:3T99\|A	50	377	N/A	PDB
Pfam:His_Phos_2	390	886	3.9e-101	PFAM
low complexity region	1143	1161	N/A	INTRINSIC
coiled coil region	1382	1410	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110639
AA Change: P2532S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106269
Gene: ENSMUSG00000027254
AA Change: P2532S

Domain	Start	End	E-Value	Type
Blast:Lactamase_B	48	300	3e-54	BLAST
SCOP:d1eq1a_	346	461	1e-4	SMART
low complexity region	505	517	N/A	INTRINSIC
low complexity region	582	595	N/A	INTRINSIC
low complexity region	614	629	N/A	INTRINSIC
low complexity region	659	673	N/A	INTRINSIC
low complexity region	990	1001	N/A	INTRINSIC
low complexity region	1096	1106	N/A	INTRINSIC
low complexity region	1302	1317	N/A	INTRINSIC
coiled coil region	1335	1364	N/A	INTRINSIC
internal_repeat_1	1378	1488	5.43e-6	PROSPERO
coiled coil region	1509	1533	N/A	INTRINSIC
internal_repeat_1	1536	1650	5.43e-6	PROSPERO
low complexity region	1822	1846	N/A	INTRINSIC
low complexity region	1883	1895	N/A	INTRINSIC
low complexity region	1918	1931	N/A	INTRINSIC
low complexity region	2145	2158	N/A	INTRINSIC
low complexity region	2198	2222	N/A	INTRINSIC
low complexity region	2279	2303	N/A	INTRINSIC
low complexity region	2351	2362	N/A	INTRINSIC
low complexity region	2424	2444	N/A	INTRINSIC
low complexity region	2447	2466	N/A	INTRINSIC
low complexity region	2478	2490	N/A	INTRINSIC
low complexity region	2528	2552	N/A	INTRINSIC
low complexity region	2742	2750	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133283

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.7%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1A heavy chain and LC2 light chain. Expression of this gene is almost exclusively in the brain. Studies of the rat microtubule-associated protein 1A gene suggested a role in early events of spinal cord development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit Purkinje cell degeneration. Mice homozygous for a spontaneous mutation exhibit mild ataxia and Purkinje cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,067,270	E740G	probably damaging	Het
4930474N05Rik	G	T	14: 36,095,457	V105F	possibly damaging	Het
4932438A13Rik	A	G	3: 37,006,983		probably null	Het
Actr10	A	G	12: 70,942,330	I74M	probably benign	Het
Aen	T	C	7: 78,905,912	Y108H	probably damaging	Het
Afm	A	T	5: 90,524,920	K205*	probably null	Het
Ankrd27	T	A	7: 35,632,985	S846T	probably benign	Het
Ano3	A	G	2: 110,885,007	S29P	probably benign	Het
Apaf1	C	T	10: 91,077,614	W138*	probably null	Het
Arfgef1	C	T	1: 10,199,878	A349T	probably benign	Het
Arhgef4	A	G	1: 34,811,140	Q1798R	probably damaging	Het
Astn1	G	A	1: 158,509,971	V416I	probably damaging	Het
Atxn2l	G	A	7: 126,493,168	T70I	probably damaging	Het
Auh	G	A	13: 52,835,496	P308L	probably benign	Het
Bspry	T	A	4: 62,494,797	C256S	probably damaging	Het
C3	C	A	17: 57,220,135	W771C	probably damaging	Het
Camkv	A	G	9: 107,947,088	D233G	possibly damaging	Het
Catsperd	T	A	17: 56,635,548	V109E	probably damaging	Het
Cd101	A	G	3: 101,018,917	L162P	probably damaging	Het
Cdr2l	A	G	11: 115,392,777	T154A	probably damaging	Het
Clca3a2	G	C	3: 144,810,696	Q380E	probably benign	Het
Col6a3	T	C	1: 90,822,359	N251S	possibly damaging	Het
Cttnbp2nl	A	G	3: 105,011,278	V82A	possibly damaging	Het
Cux1	G	A	5: 136,363,319	Q194*	probably null	Het
Daam2	T	C	17: 49,485,457	E361G	probably benign	Het
Dcaf17	A	T	2: 71,078,172		probably null	Het
Dnaic1	T	C	4: 41,570,020		probably null	Het
Eml5	T	C	12: 98,798,839	Y1617C	probably damaging	Het
Epb41l4b	T	C	4: 57,040,993	E490G	probably damaging	Het
Epha7	T	C	4: 28,963,969	M988T	possibly damaging	Het
Fancm	T	C	12: 65,105,520	C917R	possibly damaging	Het
Fnip1	C	T	11: 54,480,684	T177I	probably damaging	Het
Gm12169	A	G	11: 46,528,531	D58G	possibly damaging	Het
Gm3604	G	T	13: 62,369,942	H201N	probably benign	Het
Gnpda1	T	C	18: 38,333,190		probably null	Het
Gpatch8	A	G	11: 102,508,142		probably null	Het
H2-M3	T	C	17: 37,271,189	Y179H	possibly damaging	Het
H2-Q10	C	A	17: 35,470,488	S62R	probably damaging	Het
Hipk2	G	A	6: 38,818,984	R117*	probably null	Het
Hrg	A	T	16: 22,954,457	Q113H	probably damaging	Het
Kcnj16	T	C	11: 111,024,953	V147A	possibly damaging	Het
Kif1a	T	C	1: 93,019,031	I1650V	possibly damaging	Het
Kmt2a	C	T	9: 44,820,345		probably benign	Het
Krt90	A	T	15: 101,557,230	Y319N	probably damaging	Het
Lipo4	T	C	19: 33,499,271	N359S	possibly damaging	Het
Lrp1b	G	T	2: 41,728,729	T225K	probably benign	Het
Mmrn2	A	G	14: 34,397,643	D193G	probably benign	Het
Mpped2	T	A	2: 106,867,032	I284N	probably damaging	Het
Msh6	A	G	17: 87,985,125	H436R	probably benign	Het
Mterf3	A	T	13: 66,930,062	S48T	probably damaging	Het
Muc5b	T	C	7: 141,846,031	F414L	unknown	Het
Mylk4	A	T	13: 32,724,853	D90E	probably benign	Het
Nploc4	A	G	11: 120,404,229	Y420H	probably damaging	Het
Npr2	T	A	4: 43,640,578	Y344N	probably damaging	Het
Nsun5	A	G	5: 135,375,598	T397A	probably benign	Het
Ntsr2	A	T	12: 16,654,110	Q204L	probably damaging	Het
Nwd2	T	A	5: 63,806,180	Y1036N	probably damaging	Het
Oacyl	T	C	18: 65,710,547	V105A	possibly damaging	Het
Olfr791	T	A	10: 129,527,049	V274D	probably damaging	Het
Parp3	T	A	9: 106,475,117	Q70L	possibly damaging	Het
Parp4	T	C	14: 56,624,017	S936P	probably damaging	Het
Pdzd3	T	C	9: 44,250,303	D93G	possibly damaging	Het
Phkb	A	G	8: 85,922,161	E202G	probably benign	Het
Pink1	T	C	4: 138,314,020	N530S	probably benign	Het
Pou3f2	T	C	4: 22,487,119	D338G	probably damaging	Het
Prss8	G	T	7: 127,929,858	L9I	probably benign	Het
Ptpn22	G	A	3: 103,876,738		probably null	Het
Rad54b	A	C	4: 11,601,693	N416T	probably damaging	Het
Rasef	A	G	4: 73,744,114	S200P	possibly damaging	Het
Rb1	T	A	14: 73,212,990	K645*	probably null	Het
Robo2	C	T	16: 73,899,154	G1367D	probably benign	Het
Rp1	A	G	1: 4,352,671	V52A	probably damaging	Het
Samd13	T	C	3: 146,662,712	T23A	probably benign	Het
Scn7a	T	C	2: 66,699,973	H676R	probably damaging	Het
Serpinb6b	A	G	13: 32,978,240	I222V	probably benign	Het
Slc2a8	T	C	2: 32,980,079	Y150C	probably damaging	Het
Slc7a6os	C	A	8: 106,210,564	R88L	probably damaging	Het
Slc8a2	A	G	7: 16,152,920	I657V	probably benign	Het
Slit2	C	A	5: 48,191,016		probably benign	Het
Spire2	A	G	8: 123,363,071	D447G	probably benign	Het
Sptlc3	A	G	2: 139,566,675	N237D	possibly damaging	Het
Stk3	G	A	15: 35,073,217	T119I	probably damaging	Het
Suv39h2	G	A	2: 3,464,316	T334I	probably damaging	Het
Syt5	G	T	7: 4,540,279	T327N	probably damaging	Het
Tcof1	T	C	18: 60,816,084	D1253G	possibly damaging	Het
Tnks	A	T	8: 34,875,232	V388D	probably damaging	Het
Ugt2b1	T	C	5: 86,926,000	T167A	probably benign	Het
Usp40	G	A	1: 87,995,842	R236C	possibly damaging	Het
Utrn	T	C	10: 12,455,480	D2904G	probably benign	Het
Vmn1r226	T	C	17: 20,687,580	S25P	probably damaging	Het
Vmn2r23	T	C	6: 123,713,010	S282P	possibly damaging	Het
Vps45	T	C	3: 96,046,440	E200G	probably benign	Het
Wnt7b	T	A	15: 85,559,080	I41F	probably damaging	Het
Zmym6	T	A	4: 127,103,414	N275K	probably damaging	Het

Other mutations in Map1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Map1a	APN	2	121299027	missense	probably damaging	0.99
IGL00826:Map1a	APN	2	121302276	missense	possibly damaging	0.87
IGL01476:Map1a	APN	2	121305207	missense	probably damaging	1.00
IGL02029:Map1a	APN	2	121303298	missense	possibly damaging	0.57
IGL02100:Map1a	APN	2	121302846	missense	probably damaging	0.99
IGL02136:Map1a	APN	2	121300212	missense	probably damaging	1.00
IGL02146:Map1a	APN	2	121299446	missense	probably damaging	1.00
IGL02264:Map1a	APN	2	121307313	missense	probably damaging	1.00
IGL02456:Map1a	APN	2	121298653	missense	probably damaging	1.00
IGL02485:Map1a	APN	2	121299288	missense	probably damaging	1.00
IGL02535:Map1a	APN	2	121302177	nonsense	probably null
IGL02628:Map1a	APN	2	121300104	missense	probably damaging	1.00
IGL02721:Map1a	APN	2	121304037	missense	probably benign	0.44
IGL03273:Map1a	APN	2	121300238	missense	probably damaging	1.00
IGL03281:Map1a	APN	2	121305060	missense	probably damaging	1.00
IGL02991:Map1a	UTSW	2	121301610	missense	probably damaging	0.99
R0096:Map1a	UTSW	2	121301505	missense	probably damaging	1.00
R0096:Map1a	UTSW	2	121301505	missense	probably damaging	1.00
R0218:Map1a	UTSW	2	121305425	missense	probably benign	0.00
R0363:Map1a	UTSW	2	121302044	missense	probably damaging	1.00
R0450:Map1a	UTSW	2	121305774	missense	probably benign	0.27
R0469:Map1a	UTSW	2	121305774	missense	probably benign	0.27
R0477:Map1a	UTSW	2	121302101	missense	probably damaging	1.00
R0504:Map1a	UTSW	2	121302941	missense	probably benign	0.03
R0510:Map1a	UTSW	2	121305774	missense	probably benign	0.27
R0521:Map1a	UTSW	2	121305753	missense	probably damaging	1.00
R0601:Map1a	UTSW	2	121298602	missense	probably damaging	1.00
R0619:Map1a	UTSW	2	121305255	missense	probably damaging	0.96
R0633:Map1a	UTSW	2	121308014	missense	probably damaging	1.00
R0652:Map1a	UTSW	2	121302783	missense	probably benign	0.04
R0893:Map1a	UTSW	2	121300533	missense	probably damaging	1.00
R0960:Map1a	UTSW	2	121301643	missense	probably benign	0.16
R1115:Map1a	UTSW	2	121307378	splice site	probably null
R1166:Map1a	UTSW	2	121300260	missense	probably damaging	1.00
R1326:Map1a	UTSW	2	121306190	nonsense	probably null
R1331:Map1a	UTSW	2	121306220	nonsense	probably null
R1395:Map1a	UTSW	2	121303925	missense	probably benign	0.26
R1489:Map1a	UTSW	2	121300437	missense	possibly damaging	0.91
R1573:Map1a	UTSW	2	121304126	missense	probably benign	0.37
R1596:Map1a	UTSW	2	121289765	missense	probably benign	0.00
R1662:Map1a	UTSW	2	121306408	missense	possibly damaging	0.90
R1675:Map1a	UTSW	2	121302655	nonsense	probably null
R2122:Map1a	UTSW	2	121299446	missense	probably damaging	1.00
R2126:Map1a	UTSW	2	121298641	missense	probably damaging	0.96
R2143:Map1a	UTSW	2	121301945	missense	probably damaging	1.00
R2172:Map1a	UTSW	2	121307932	missense	probably damaging	1.00
R2249:Map1a	UTSW	2	121300287	missense	probably damaging	1.00
R2254:Map1a	UTSW	2	121303791	missense	possibly damaging	0.71
R2255:Map1a	UTSW	2	121303791	missense	possibly damaging	0.71
R3834:Map1a	UTSW	2	121307322	missense	probably damaging	1.00
R4011:Map1a	UTSW	2	121300127	missense	probably damaging	1.00
R4346:Map1a	UTSW	2	121301325	missense	probably benign	0.13
R4842:Map1a	UTSW	2	121302086	missense	probably damaging	1.00
R4933:Map1a	UTSW	2	121305905	missense	probably damaging	1.00
R4978:Map1a	UTSW	2	121301142	missense	probably benign	0.00
R4988:Map1a	UTSW	2	121303050	missense	probably benign	0.34
R5026:Map1a	UTSW	2	121307538	missense	possibly damaging	0.83
R5086:Map1a	UTSW	2	121304504	missense	probably damaging	1.00
R5155:Map1a	UTSW	2	121302386	missense	probably damaging	1.00
R5232:Map1a	UTSW	2	121301985	missense	probably damaging	1.00
R5311:Map1a	UTSW	2	121302387	missense	probably damaging	1.00
R5401:Map1a	UTSW	2	121299672	missense	probably damaging	1.00
R5465:Map1a	UTSW	2	121306025	missense	probably damaging	1.00
R5526:Map1a	UTSW	2	121305662	missense	probably damaging	1.00
R5642:Map1a	UTSW	2	121306043	missense	probably damaging	1.00
R5726:Map1a	UTSW	2	121305065	missense	probably damaging	1.00
R5817:Map1a	UTSW	2	121298910	missense	possibly damaging	0.81
R5855:Map1a	UTSW	2	121303674	missense	possibly damaging	0.74
R5917:Map1a	UTSW	2	121305216	missense	probably damaging	1.00
R5974:Map1a	UTSW	2	121304376	missense	probably benign	0.20
R5987:Map1a	UTSW	2	121304295	missense	possibly damaging	0.56
R6151:Map1a	UTSW	2	121289823	missense	probably benign	0.12
R6406:Map1a	UTSW	2	121300743	missense	probably damaging	1.00
R7014:Map1a	UTSW	2	121300239	missense	probably damaging	1.00
R7099:Map1a	UTSW	2	121300517	missense	probably benign	0.04
R7211:Map1a	UTSW	2	121304643	missense	probably benign	0.02
R7230:Map1a	UTSW	2	121300818	missense	probably damaging	1.00
R7305:Map1a	UTSW	2	121299458	missense	probably damaging	1.00
R7382:Map1a	UTSW	2	121290785	missense	probably damaging	1.00
R7524:Map1a	UTSW	2	121289812	missense	probably damaging	1.00
R7699:Map1a	UTSW	2	121299720	missense	probably damaging	1.00
R7767:Map1a	UTSW	2	121302036	missense	probably damaging	1.00
R7883:Map1a	UTSW	2	121305372	missense	probably damaging	1.00
R7896:Map1a	UTSW	2	121305176	missense	probably benign	0.00
R7993:Map1a	UTSW	2	121304576	missense	possibly damaging	0.84
R8270:Map1a	UTSW	2	121299020	missense	probably damaging	0.99
R8365:Map1a	UTSW	2	121308047	missense	probably damaging	1.00
R8428:Map1a	UTSW	2	121304937	missense	probably benign	0.42
RF003:Map1a	UTSW	2	121306296	small insertion	probably benign
RF007:Map1a	UTSW	2	121306308	small insertion	probably benign
RF009:Map1a	UTSW	2	121306301	small insertion	probably benign
RF010:Map1a	UTSW	2	121306318	small insertion	probably benign
RF014:Map1a	UTSW	2	121306295	small insertion	probably benign
RF017:Map1a	UTSW	2	121306308	small insertion	probably benign
RF024:Map1a	UTSW	2	121306307	small insertion	probably benign
RF025:Map1a	UTSW	2	121306294	small insertion	probably benign
RF030:Map1a	UTSW	2	121306311	small insertion	probably benign
RF030:Map1a	UTSW	2	121306317	small insertion	probably benign
RF033:Map1a	UTSW	2	121306299	small insertion	probably benign
RF034:Map1a	UTSW	2	121306304	small insertion	probably benign
RF034:Map1a	UTSW	2	121306307	small insertion	probably benign
RF035:Map1a	UTSW	2	121306301	small insertion	probably benign
RF037:Map1a	UTSW	2	121306294	small insertion	probably benign
RF039:Map1a	UTSW	2	121306304	small insertion	probably benign
RF042:Map1a	UTSW	2	121306287	small insertion	probably benign
RF044:Map1a	UTSW	2	121306293	small insertion	probably benign
RF045:Map1a	UTSW	2	121306293	small insertion	probably benign
RF051:Map1a	UTSW	2	121306296	small insertion	probably benign
RF052:Map1a	UTSW	2	121306295	small insertion	probably benign
RF053:Map1a	UTSW	2	121306290	small insertion	probably benign
RF060:Map1a	UTSW	2	121306318	small insertion	probably benign
RF061:Map1a	UTSW	2	121306287	small insertion	probably benign
Z1176:Map1a	UTSW	2	121303238	missense	possibly damaging	0.95
Z1177:Map1a	UTSW	2	121305279	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TATGGCTGATGAGACACCCC -3'
(R):5'- GTGACCGTTTTCCCCGAATATC -3'

Sequencing Primer
(F):5'- CCCCACATCAGCCAGCG -3'
(R):5'- GTTTTCCCCGAATATCCAGACG -3'

Posted On

2014-07-14