Incidental Mutation 'R1919:Sptlc3'
ID212809
Institutional Source Beutler Lab
Gene Symbol Sptlc3
Ensembl Gene ENSMUSG00000039092
Gene Nameserine palmitoyltransferase, long chain base subunit 3
Synonyms
MMRRC Submission 039937-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R1919 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location139493913-139637674 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139566675 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 237 (N237D)
Ref Sequence ENSEMBL: ENSMUSP00000105710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047370] [ENSMUST00000110083]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047370
AA Change: N237D

PolyPhen 2 Score 0.661 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000048313
Gene: ENSMUSG00000039092
AA Change: N237D

DomainStartEndE-ValueType
transmembrane domain 60 79 N/A INTRINSIC
Pfam:Aminotran_1_2 160 520 4.8e-59 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110083
AA Change: N237D

PolyPhen 2 Score 0.661 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105710
Gene: ENSMUSG00000039092
AA Change: N237D

DomainStartEndE-ValueType
transmembrane domain 60 79 N/A INTRINSIC
Pfam:Aminotran_1_2 160 520 4.8e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134801
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The SPTLC3 gene encodes an isoform of the third subunit of serine palmitoyltransferase (SPT; EC 2.3.1.50), which catalyzes the rate-limiting step of the de novo synthesis of sphingolipids (Hornemann et al., 2006 [PubMed 17023427]). SPT contains 2 main subunits: the common SPTLC1 subunit (MIM 605712) and either SPTLC2 (MIM 605713) or its isoform SPTLC2L (SPTLC3), depending on the tissue in which biosynthesis occurs (Hornemann et al., 2006 [PubMed 17023427]). There are also 2 highly related isoforms of a third subunit, SSSPTA (MIM 613540) and SSSPTB (MIM 610412), that confer acyl-CoA preference of the SPT enzyme and are essential for maximal enzyme activity (Han et al., 2009 [PubMed 19416851]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,270 E740G probably damaging Het
4930474N05Rik G T 14: 36,095,457 V105F possibly damaging Het
4932438A13Rik A G 3: 37,006,983 probably null Het
Actr10 A G 12: 70,942,330 I74M probably benign Het
Aen T C 7: 78,905,912 Y108H probably damaging Het
Afm A T 5: 90,524,920 K205* probably null Het
Ankrd27 T A 7: 35,632,985 S846T probably benign Het
Ano3 A G 2: 110,885,007 S29P probably benign Het
Apaf1 C T 10: 91,077,614 W138* probably null Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgef4 A G 1: 34,811,140 Q1798R probably damaging Het
Astn1 G A 1: 158,509,971 V416I probably damaging Het
Atxn2l G A 7: 126,493,168 T70I probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bspry T A 4: 62,494,797 C256S probably damaging Het
C3 C A 17: 57,220,135 W771C probably damaging Het
Camkv A G 9: 107,947,088 D233G possibly damaging Het
Catsperd T A 17: 56,635,548 V109E probably damaging Het
Cd101 A G 3: 101,018,917 L162P probably damaging Het
Cdr2l A G 11: 115,392,777 T154A probably damaging Het
Clca3a2 G C 3: 144,810,696 Q380E probably benign Het
Col6a3 T C 1: 90,822,359 N251S possibly damaging Het
Cttnbp2nl A G 3: 105,011,278 V82A possibly damaging Het
Cux1 G A 5: 136,363,319 Q194* probably null Het
Daam2 T C 17: 49,485,457 E361G probably benign Het
Dcaf17 A T 2: 71,078,172 probably null Het
Dnaic1 T C 4: 41,570,020 probably null Het
Eml5 T C 12: 98,798,839 Y1617C probably damaging Het
Epb41l4b T C 4: 57,040,993 E490G probably damaging Het
Epha7 T C 4: 28,963,969 M988T possibly damaging Het
Fancm T C 12: 65,105,520 C917R possibly damaging Het
Fnip1 C T 11: 54,480,684 T177I probably damaging Het
Gm12169 A G 11: 46,528,531 D58G possibly damaging Het
Gm3604 G T 13: 62,369,942 H201N probably benign Het
Gnpda1 T C 18: 38,333,190 probably null Het
Gpatch8 A G 11: 102,508,142 probably null Het
H2-M3 T C 17: 37,271,189 Y179H possibly damaging Het
H2-Q10 C A 17: 35,470,488 S62R probably damaging Het
Hipk2 G A 6: 38,818,984 R117* probably null Het
Hrg A T 16: 22,954,457 Q113H probably damaging Het
Kcnj16 T C 11: 111,024,953 V147A possibly damaging Het
Kif1a T C 1: 93,019,031 I1650V possibly damaging Het
Kmt2a C T 9: 44,820,345 probably benign Het
Krt90 A T 15: 101,557,230 Y319N probably damaging Het
Lipo4 T C 19: 33,499,271 N359S possibly damaging Het
Lrp1b G T 2: 41,728,729 T225K probably benign Het
Map1a C T 2: 121,307,012 P2532S probably damaging Het
Mmrn2 A G 14: 34,397,643 D193G probably benign Het
Mpped2 T A 2: 106,867,032 I284N probably damaging Het
Msh6 A G 17: 87,985,125 H436R probably benign Het
Mterf3 A T 13: 66,930,062 S48T probably damaging Het
Muc5b T C 7: 141,846,031 F414L unknown Het
Mylk4 A T 13: 32,724,853 D90E probably benign Het
Nploc4 A G 11: 120,404,229 Y420H probably damaging Het
Npr2 T A 4: 43,640,578 Y344N probably damaging Het
Nsun5 A G 5: 135,375,598 T397A probably benign Het
Ntsr2 A T 12: 16,654,110 Q204L probably damaging Het
Nwd2 T A 5: 63,806,180 Y1036N probably damaging Het
Oacyl T C 18: 65,710,547 V105A possibly damaging Het
Olfr791 T A 10: 129,527,049 V274D probably damaging Het
Parp3 T A 9: 106,475,117 Q70L possibly damaging Het
Parp4 T C 14: 56,624,017 S936P probably damaging Het
Pdzd3 T C 9: 44,250,303 D93G possibly damaging Het
Phkb A G 8: 85,922,161 E202G probably benign Het
Pink1 T C 4: 138,314,020 N530S probably benign Het
Pou3f2 T C 4: 22,487,119 D338G probably damaging Het
Prss8 G T 7: 127,929,858 L9I probably benign Het
Ptpn22 G A 3: 103,876,738 probably null Het
Rad54b A C 4: 11,601,693 N416T probably damaging Het
Rasef A G 4: 73,744,114 S200P possibly damaging Het
Rb1 T A 14: 73,212,990 K645* probably null Het
Robo2 C T 16: 73,899,154 G1367D probably benign Het
Rp1 A G 1: 4,352,671 V52A probably damaging Het
Samd13 T C 3: 146,662,712 T23A probably benign Het
Scn7a T C 2: 66,699,973 H676R probably damaging Het
Serpinb6b A G 13: 32,978,240 I222V probably benign Het
Slc2a8 T C 2: 32,980,079 Y150C probably damaging Het
Slc7a6os C A 8: 106,210,564 R88L probably damaging Het
Slc8a2 A G 7: 16,152,920 I657V probably benign Het
Slit2 C A 5: 48,191,016 probably benign Het
Spire2 A G 8: 123,363,071 D447G probably benign Het
Stk3 G A 15: 35,073,217 T119I probably damaging Het
Suv39h2 G A 2: 3,464,316 T334I probably damaging Het
Syt5 G T 7: 4,540,279 T327N probably damaging Het
Tcof1 T C 18: 60,816,084 D1253G possibly damaging Het
Tnks A T 8: 34,875,232 V388D probably damaging Het
Ugt2b1 T C 5: 86,926,000 T167A probably benign Het
Usp40 G A 1: 87,995,842 R236C possibly damaging Het
Utrn T C 10: 12,455,480 D2904G probably benign Het
Vmn1r226 T C 17: 20,687,580 S25P probably damaging Het
Vmn2r23 T C 6: 123,713,010 S282P possibly damaging Het
Vps45 T C 3: 96,046,440 E200G probably benign Het
Wnt7b T A 15: 85,559,080 I41F probably damaging Het
Zmym6 T A 4: 127,103,414 N275K probably damaging Het
Other mutations in Sptlc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Sptlc3 APN 2 139546421 missense possibly damaging 0.55
IGL01537:Sptlc3 APN 2 139589695 missense possibly damaging 0.95
IGL01996:Sptlc3 APN 2 139581504 splice site probably benign
IGL02512:Sptlc3 APN 2 139547203 missense probably damaging 1.00
IGL03278:Sptlc3 APN 2 139589659 missense probably damaging 1.00
IGL03286:Sptlc3 APN 2 139589659 missense probably damaging 1.00
R0266:Sptlc3 UTSW 2 139596037 missense possibly damaging 0.93
R0362:Sptlc3 UTSW 2 139546555 splice site probably benign
R1464:Sptlc3 UTSW 2 139547234 missense probably benign 0.00
R1464:Sptlc3 UTSW 2 139547234 missense probably benign 0.00
R1494:Sptlc3 UTSW 2 139589560 missense possibly damaging 0.58
R1847:Sptlc3 UTSW 2 139625923 missense probably benign 0.08
R2093:Sptlc3 UTSW 2 139625874 missense possibly damaging 0.89
R2396:Sptlc3 UTSW 2 139566586 missense probably benign 0.44
R2972:Sptlc3 UTSW 2 139589661 missense probably damaging 1.00
R2973:Sptlc3 UTSW 2 139589661 missense probably damaging 1.00
R2974:Sptlc3 UTSW 2 139589661 missense probably damaging 1.00
R4601:Sptlc3 UTSW 2 139636680 missense probably benign 0.01
R4602:Sptlc3 UTSW 2 139636680 missense probably benign 0.01
R4610:Sptlc3 UTSW 2 139636680 missense probably benign 0.01
R4745:Sptlc3 UTSW 2 139547167 missense probably damaging 1.00
R4779:Sptlc3 UTSW 2 139589589 missense probably benign 0.04
R4992:Sptlc3 UTSW 2 139596003 missense probably benign 0.04
R5162:Sptlc3 UTSW 2 139631343 missense probably benign 0.11
R5401:Sptlc3 UTSW 2 139636723 missense possibly damaging 0.75
R5406:Sptlc3 UTSW 2 139546478 missense probably benign 0.26
R5642:Sptlc3 UTSW 2 139546408 missense probably damaging 0.96
R5840:Sptlc3 UTSW 2 139547206 missense probably damaging 1.00
R6057:Sptlc3 UTSW 2 139581613 missense probably damaging 0.99
R6376:Sptlc3 UTSW 2 139636772 missense probably benign 0.21
R6852:Sptlc3 UTSW 2 139566586 missense probably benign 0.44
R7026:Sptlc3 UTSW 2 139537688 missense probably benign
R7412:Sptlc3 UTSW 2 139589617 missense possibly damaging 0.75
R7516:Sptlc3 UTSW 2 139589518 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CTTGCTATGCTACAGGTCTGTG -3'
(R):5'- CTCAATACCTGGGAGTATCACAATC -3'

Sequencing Primer
(F):5'- CTATGCTACAGGTCTGTGTTGGTG -3'
(R):5'- TACCTGGGAGTATCACAATCAAAAG -3'
Posted On2014-07-14