Mutagenetix > Incidental Mutation

Incidental Mutation 'R1919:4932438A13Rik'

212811

Institutional Source

Beutler Lab

Gene Symbol

4932438A13Rik

Ensembl Gene

ENSMUSG00000037270

Gene Name

RIKEN cDNA 4932438A13 gene

Synonyms

Tweek, FSA

MMRRC Submission

039937-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1919 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

36863104-37053033 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to G at 37006983 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000117808 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057272] [ENSMUST00000138950] [ENSMUST00000152564]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000057272

SMART Domains

Protein: ENSMUSP00000060199
Gene: ENSMUSG00000037270

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
low complexity region	701	716	N/A	INTRINSIC
low complexity region	767	779	N/A	INTRINSIC
low complexity region	1127	1138	N/A	INTRINSIC
low complexity region	1154	1166	N/A	INTRINSIC
low complexity region	1226	1240	N/A	INTRINSIC
low complexity region	1381	1402	N/A	INTRINSIC
low complexity region	1541	1547	N/A	INTRINSIC
low complexity region	1593	1607	N/A	INTRINSIC
low complexity region	1810	1821	N/A	INTRINSIC
low complexity region	1981	1995	N/A	INTRINSIC
low complexity region	2182	2191	N/A	INTRINSIC
low complexity region	2336	2349	N/A	INTRINSIC
low complexity region	2614	2657	N/A	INTRINSIC
low complexity region	3468	3480	N/A	INTRINSIC
low complexity region	3717	3742	N/A	INTRINSIC
low complexity region	3816	3837	N/A	INTRINSIC
low complexity region	3919	3929	N/A	INTRINSIC
low complexity region	3941	3948	N/A	INTRINSIC
low complexity region	4024	4038	N/A	INTRINSIC
low complexity region	4041	4049	N/A	INTRINSIC
low complexity region	4117	4149	N/A	INTRINSIC
low complexity region	4172	4185	N/A	INTRINSIC
low complexity region	4359	4380	N/A	INTRINSIC
FSA_C	4386	4990	N/A	SMART
low complexity region	4993	5004	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000138950

SMART Domains

Protein: ENSMUSP00000118092
Gene: ENSMUSG00000037270

Domain	Start	End	E-Value	Type
low complexity region	254	279	N/A	INTRINSIC
low complexity region	353	374	N/A	INTRINSIC
low complexity region	526	540	N/A	INTRINSIC
low complexity region	543	551	N/A	INTRINSIC
low complexity region	619	651	N/A	INTRINSIC
low complexity region	674	687	N/A	INTRINSIC
low complexity region	861	882	N/A	INTRINSIC
FSA_C	888	1492	N/A	SMART
low complexity region	1495	1506	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141740

SMART Domains

Protein: ENSMUSP00000117814
Gene: ENSMUSG00000037270

Domain	Start	End	E-Value	Type
low complexity region	28	40	N/A	INTRINSIC
low complexity region	298	323	N/A	INTRINSIC
low complexity region	397	418	N/A	INTRINSIC
low complexity region	500	510	N/A	INTRINSIC
low complexity region	522	529	N/A	INTRINSIC
low complexity region	605	619	N/A	INTRINSIC
low complexity region	622	630	N/A	INTRINSIC
low complexity region	698	730	N/A	INTRINSIC
low complexity region	753	766	N/A	INTRINSIC
low complexity region	940	961	N/A	INTRINSIC
FSA_C	967	1571	N/A	SMART
low complexity region	1574	1585	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000146948

SMART Domains

Protein: ENSMUSP00000121356
Gene: ENSMUSG00000037270

Domain	Start	End	E-Value	Type
low complexity region	121	133	N/A	INTRINSIC
low complexity region	167	177	N/A	INTRINSIC
low complexity region	458	483	N/A	INTRINSIC
low complexity region	557	578	N/A	INTRINSIC
low complexity region	730	744	N/A	INTRINSIC
low complexity region	747	755	N/A	INTRINSIC
low complexity region	823	855	N/A	INTRINSIC
low complexity region	878	891	N/A	INTRINSIC
low complexity region	1065	1086	N/A	INTRINSIC
FSA_C	1092	1696	N/A	SMART
low complexity region	1699	1710	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000152564

SMART Domains

Protein: ENSMUSP00000117808
Gene: ENSMUSG00000037270

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
low complexity region	701	716	N/A	INTRINSIC
low complexity region	767	779	N/A	INTRINSIC
low complexity region	1127	1138	N/A	INTRINSIC
low complexity region	1154	1166	N/A	INTRINSIC
low complexity region	1226	1240	N/A	INTRINSIC
low complexity region	1381	1402	N/A	INTRINSIC
low complexity region	1541	1547	N/A	INTRINSIC
low complexity region	1593	1607	N/A	INTRINSIC
low complexity region	1810	1821	N/A	INTRINSIC
low complexity region	1981	1995	N/A	INTRINSIC
low complexity region	2182	2191	N/A	INTRINSIC
low complexity region	2336	2349	N/A	INTRINSIC
low complexity region	2614	2657	N/A	INTRINSIC
low complexity region	3468	3480	N/A	INTRINSIC
low complexity region	3717	3742	N/A	INTRINSIC
low complexity region	3816	3837	N/A	INTRINSIC
low complexity region	3919	3929	N/A	INTRINSIC
low complexity region	3941	3948	N/A	INTRINSIC
low complexity region	4024	4038	N/A	INTRINSIC
low complexity region	4041	4049	N/A	INTRINSIC
low complexity region	4117	4149	N/A	INTRINSIC
low complexity region	4172	4185	N/A	INTRINSIC
low complexity region	4359	4380	N/A	INTRINSIC
FSA_C	4386	4990	N/A	SMART
low complexity region	4993	5004	N/A	INTRINSIC

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.7%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located on the long arm of chromosome 4 in a region that is associated with susceptibility to celiac disease. The encoded protein is similar to a Chinese hamster protein that is associated with spermatocyte and adipocyte differentiation. The C-terminus of the protein is also similar to a Caenorhabditis elegans protein that plays a role in lipid storage. In mammals, this protein is thought to function in the regulation of epithelial growth and differentiation, and in tumor development. [provided by RefSeq, Oct 2009]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,067,270	E740G	probably damaging	Het
4930474N05Rik	G	T	14: 36,095,457	V105F	possibly damaging	Het
Actr10	A	G	12: 70,942,330	I74M	probably benign	Het
Aen	T	C	7: 78,905,912	Y108H	probably damaging	Het
Afm	A	T	5: 90,524,920	K205*	probably null	Het
Ankrd27	T	A	7: 35,632,985	S846T	probably benign	Het
Ano3	A	G	2: 110,885,007	S29P	probably benign	Het
Apaf1	C	T	10: 91,077,614	W138*	probably null	Het
Arfgef1	C	T	1: 10,199,878	A349T	probably benign	Het
Arhgef4	A	G	1: 34,811,140	Q1798R	probably damaging	Het
Astn1	G	A	1: 158,509,971	V416I	probably damaging	Het
Atxn2l	G	A	7: 126,493,168	T70I	probably damaging	Het
Auh	G	A	13: 52,835,496	P308L	probably benign	Het
Bspry	T	A	4: 62,494,797	C256S	probably damaging	Het
C3	C	A	17: 57,220,135	W771C	probably damaging	Het
Camkv	A	G	9: 107,947,088	D233G	possibly damaging	Het
Catsperd	T	A	17: 56,635,548	V109E	probably damaging	Het
Cd101	A	G	3: 101,018,917	L162P	probably damaging	Het
Cdr2l	A	G	11: 115,392,777	T154A	probably damaging	Het
Clca3a2	G	C	3: 144,810,696	Q380E	probably benign	Het
Col6a3	T	C	1: 90,822,359	N251S	possibly damaging	Het
Cttnbp2nl	A	G	3: 105,011,278	V82A	possibly damaging	Het
Cux1	G	A	5: 136,363,319	Q194*	probably null	Het
Daam2	T	C	17: 49,485,457	E361G	probably benign	Het
Dcaf17	A	T	2: 71,078,172		probably null	Het
Dnaic1	T	C	4: 41,570,020		probably null	Het
Eml5	T	C	12: 98,798,839	Y1617C	probably damaging	Het
Epb41l4b	T	C	4: 57,040,993	E490G	probably damaging	Het
Epha7	T	C	4: 28,963,969	M988T	possibly damaging	Het
Fancm	T	C	12: 65,105,520	C917R	possibly damaging	Het
Fnip1	C	T	11: 54,480,684	T177I	probably damaging	Het
Gm12169	A	G	11: 46,528,531	D58G	possibly damaging	Het
Gm3604	G	T	13: 62,369,942	H201N	probably benign	Het
Gnpda1	T	C	18: 38,333,190		probably null	Het
Gpatch8	A	G	11: 102,508,142		probably null	Het
H2-M3	T	C	17: 37,271,189	Y179H	possibly damaging	Het
H2-Q10	C	A	17: 35,470,488	S62R	probably damaging	Het
Hipk2	G	A	6: 38,818,984	R117*	probably null	Het
Hrg	A	T	16: 22,954,457	Q113H	probably damaging	Het
Kcnj16	T	C	11: 111,024,953	V147A	possibly damaging	Het
Kif1a	T	C	1: 93,019,031	I1650V	possibly damaging	Het
Kmt2a	C	T	9: 44,820,345		probably benign	Het
Krt90	A	T	15: 101,557,230	Y319N	probably damaging	Het
Lipo4	T	C	19: 33,499,271	N359S	possibly damaging	Het
Lrp1b	G	T	2: 41,728,729	T225K	probably benign	Het
Map1a	C	T	2: 121,307,012	P2532S	probably damaging	Het
Mmrn2	A	G	14: 34,397,643	D193G	probably benign	Het
Mpped2	T	A	2: 106,867,032	I284N	probably damaging	Het
Msh6	A	G	17: 87,985,125	H436R	probably benign	Het
Mterf3	A	T	13: 66,930,062	S48T	probably damaging	Het
Muc5b	T	C	7: 141,846,031	F414L	unknown	Het
Mylk4	A	T	13: 32,724,853	D90E	probably benign	Het
Nploc4	A	G	11: 120,404,229	Y420H	probably damaging	Het
Npr2	T	A	4: 43,640,578	Y344N	probably damaging	Het
Nsun5	A	G	5: 135,375,598	T397A	probably benign	Het
Ntsr2	A	T	12: 16,654,110	Q204L	probably damaging	Het
Nwd2	T	A	5: 63,806,180	Y1036N	probably damaging	Het
Oacyl	T	C	18: 65,710,547	V105A	possibly damaging	Het
Olfr791	T	A	10: 129,527,049	V274D	probably damaging	Het
Parp3	T	A	9: 106,475,117	Q70L	possibly damaging	Het
Parp4	T	C	14: 56,624,017	S936P	probably damaging	Het
Pdzd3	T	C	9: 44,250,303	D93G	possibly damaging	Het
Phkb	A	G	8: 85,922,161	E202G	probably benign	Het
Pink1	T	C	4: 138,314,020	N530S	probably benign	Het
Pou3f2	T	C	4: 22,487,119	D338G	probably damaging	Het
Prss8	G	T	7: 127,929,858	L9I	probably benign	Het
Ptpn22	G	A	3: 103,876,738		probably null	Het
Rad54b	A	C	4: 11,601,693	N416T	probably damaging	Het
Rasef	A	G	4: 73,744,114	S200P	possibly damaging	Het
Rb1	T	A	14: 73,212,990	K645*	probably null	Het
Robo2	C	T	16: 73,899,154	G1367D	probably benign	Het
Rp1	A	G	1: 4,352,671	V52A	probably damaging	Het
Samd13	T	C	3: 146,662,712	T23A	probably benign	Het
Scn7a	T	C	2: 66,699,973	H676R	probably damaging	Het
Serpinb6b	A	G	13: 32,978,240	I222V	probably benign	Het
Slc2a8	T	C	2: 32,980,079	Y150C	probably damaging	Het
Slc7a6os	C	A	8: 106,210,564	R88L	probably damaging	Het
Slc8a2	A	G	7: 16,152,920	I657V	probably benign	Het
Slit2	C	A	5: 48,191,016		probably benign	Het
Spire2	A	G	8: 123,363,071	D447G	probably benign	Het
Sptlc3	A	G	2: 139,566,675	N237D	possibly damaging	Het
Stk3	G	A	15: 35,073,217	T119I	probably damaging	Het
Suv39h2	G	A	2: 3,464,316	T334I	probably damaging	Het
Syt5	G	T	7: 4,540,279	T327N	probably damaging	Het
Tcof1	T	C	18: 60,816,084	D1253G	possibly damaging	Het
Tnks	A	T	8: 34,875,232	V388D	probably damaging	Het
Ugt2b1	T	C	5: 86,926,000	T167A	probably benign	Het
Usp40	G	A	1: 87,995,842	R236C	possibly damaging	Het
Utrn	T	C	10: 12,455,480	D2904G	probably benign	Het
Vmn1r226	T	C	17: 20,687,580	S25P	probably damaging	Het
Vmn2r23	T	C	6: 123,713,010	S282P	possibly damaging	Het
Vps45	T	C	3: 96,046,440	E200G	probably benign	Het
Wnt7b	T	A	15: 85,559,080	I41F	probably damaging	Het
Zmym6	T	A	4: 127,103,414	N275K	probably damaging	Het

Other mutations in 4932438A13Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:4932438A13Rik	APN	3	37011727	missense	probably benign	0.00
IGL00434:4932438A13Rik	APN	3	36987299	missense	probably damaging	0.98
IGL00640:4932438A13Rik	APN	3	36908218	missense	probably damaging	1.00
IGL00693:4932438A13Rik	APN	3	37052547	utr 3 prime	probably benign
IGL00721:4932438A13Rik	APN	3	37030751	splice site	probably null
IGL00756:4932438A13Rik	APN	3	36908218	missense	probably damaging	1.00
IGL00896:4932438A13Rik	APN	3	37039462	missense	probably benign
IGL00902:4932438A13Rik	APN	3	37041345	missense	probably damaging	1.00
IGL00980:4932438A13Rik	APN	3	37000041	missense	probably damaging	1.00
IGL01019:4932438A13Rik	APN	3	37006984	critical splice acceptor site	probably null
IGL01025:4932438A13Rik	APN	3	37046280	missense	possibly damaging	0.89
IGL01306:4932438A13Rik	APN	3	37005013	splice site	probably benign
IGL01370:4932438A13Rik	APN	3	36947755	missense	probably benign	0.07
IGL01377:4932438A13Rik	APN	3	36973452	critical splice donor site	probably null
IGL01401:4932438A13Rik	APN	3	36942292	missense	probably benign
IGL01419:4932438A13Rik	APN	3	37048121	missense	probably damaging	1.00
IGL01432:4932438A13Rik	APN	3	37003759	missense	possibly damaging	0.87
IGL01433:4932438A13Rik	APN	3	36887770	missense	probably damaging	1.00
IGL01452:4932438A13Rik	APN	3	36996308	unclassified	probably benign
IGL01520:4932438A13Rik	APN	3	36973260	nonsense	probably null
IGL01524:4932438A13Rik	APN	3	36942382	missense	possibly damaging	0.90
IGL01628:4932438A13Rik	APN	3	37008485	missense	probably damaging	1.00
IGL01638:4932438A13Rik	APN	3	36974311	missense	probably damaging	1.00
IGL01650:4932438A13Rik	APN	3	36992673	splice site	probably benign
IGL01717:4932438A13Rik	APN	3	37034736	missense	probably benign
IGL01767:4932438A13Rik	APN	3	37041363	missense	probably benign	0.29
IGL01813:4932438A13Rik	APN	3	36928520	missense	possibly damaging	0.90
IGL01998:4932438A13Rik	APN	3	36957016	missense	possibly damaging	0.49
IGL02172:4932438A13Rik	APN	3	37004873	missense	probably damaging	0.99
IGL02197:4932438A13Rik	APN	3	36906735	missense	probably damaging	1.00
IGL02248:4932438A13Rik	APN	3	36969290	critical splice donor site	probably null
IGL02273:4932438A13Rik	APN	3	36921437	splice site	probably benign
IGL02403:4932438A13Rik	APN	3	37030664	missense	probably benign
IGL02492:4932438A13Rik	APN	3	37048113	missense	probably benign	0.04
IGL02517:4932438A13Rik	APN	3	36958868	missense	probably damaging	1.00
IGL02519:4932438A13Rik	APN	3	36895315	missense	probably damaging	1.00
IGL02586:4932438A13Rik	APN	3	37044608	nonsense	probably null
IGL02620:4932438A13Rik	APN	3	37035945	missense	possibly damaging	0.95
IGL02621:4932438A13Rik	APN	3	37041484	splice site	probably benign
IGL02670:4932438A13Rik	APN	3	36967305	nonsense	probably null
IGL02806:4932438A13Rik	APN	3	36946494	missense	possibly damaging	0.95
IGL02985:4932438A13Rik	APN	3	36958757	missense	probably damaging	0.99
IGL03004:4932438A13Rik	APN	3	36965677	splice site	probably benign
IGL03037:4932438A13Rik	APN	3	36969207	missense	probably benign	0.23
IGL03037:4932438A13Rik	APN	3	36969208	missense	probably damaging	1.00
IGL03062:4932438A13Rik	APN	3	37038517	splice site	probably benign
IGL03137:4932438A13Rik	APN	3	37034602	missense	probably damaging	0.98
IGL03150:4932438A13Rik	APN	3	36948066	missense	probably damaging	1.00
IGL03204:4932438A13Rik	APN	3	37050934	splice site	probably benign
IGL03207:4932438A13Rik	APN	3	36949996	missense	possibly damaging	0.73
IGL03256:4932438A13Rik	APN	3	36906683	splice site	probably benign
IGL03264:4932438A13Rik	APN	3	37002635	missense	probably damaging	1.00
IGL03265:4932438A13Rik	APN	3	37047991	missense	probably benign	0.00
IGL03303:4932438A13Rik	APN	3	36870077	missense	possibly damaging	0.90
admonished	UTSW	3	36948304	missense	probably damaging	1.00
alerted	UTSW	3	37033265	missense	possibly damaging	0.85
informed	UTSW	3	36965849	missense	probably damaging	1.00
resolved	UTSW	3	36921221	missense	possibly damaging	0.60
tipped	UTSW	3	36988085	missense	possibly damaging	0.81
warned	UTSW	3	36965621	missense	probably damaging	1.00
FR4340:4932438A13Rik	UTSW	3	37050752	critical splice acceptor site	probably benign
FR4737:4932438A13Rik	UTSW	3	37050754	critical splice acceptor site	probably benign
PIT4515001:4932438A13Rik	UTSW	3	36974236	missense	probably damaging	1.00
R0035:4932438A13Rik	UTSW	3	36987598	nonsense	probably null
R0047:4932438A13Rik	UTSW	3	36908192	missense	possibly damaging	0.83
R0047:4932438A13Rik	UTSW	3	36908192	missense	possibly damaging	0.83
R0068:4932438A13Rik	UTSW	3	36952221	missense	probably benign	0.28
R0068:4932438A13Rik	UTSW	3	36952221	missense	probably benign	0.28
R0092:4932438A13Rik	UTSW	3	37028159	missense	probably benign	0.41
R0233:4932438A13Rik	UTSW	3	36948563	nonsense	probably null
R0233:4932438A13Rik	UTSW	3	36948563	nonsense	probably null
R0256:4932438A13Rik	UTSW	3	36917773	missense	probably benign	0.01
R0277:4932438A13Rik	UTSW	3	36943182	nonsense	probably null
R0321:4932438A13Rik	UTSW	3	36906788	splice site	probably null
R0323:4932438A13Rik	UTSW	3	36943182	nonsense	probably null
R0335:4932438A13Rik	UTSW	3	36969152	missense	probably damaging	1.00
R0375:4932438A13Rik	UTSW	3	37046252	missense	probably damaging	0.99
R0437:4932438A13Rik	UTSW	3	36989804	missense	possibly damaging	0.81
R0445:4932438A13Rik	UTSW	3	37000065	missense	probably damaging	0.99
R0496:4932438A13Rik	UTSW	3	36987635	missense	probably damaging	1.00
R0531:4932438A13Rik	UTSW	3	37036825	missense	probably damaging	1.00
R0543:4932438A13Rik	UTSW	3	36996458	missense	probably benign	0.22
R0545:4932438A13Rik	UTSW	3	36987690	splice site	probably benign
R0674:4932438A13Rik	UTSW	3	37044626	missense	possibly damaging	0.86
R0745:4932438A13Rik	UTSW	3	36928463	missense	probably damaging	1.00
R0755:4932438A13Rik	UTSW	3	36946364	missense	probably damaging	1.00
R0785:4932438A13Rik	UTSW	3	36959334	splice site	probably benign
R1056:4932438A13Rik	UTSW	3	36983453	missense	possibly damaging	0.69
R1056:4932438A13Rik	UTSW	3	37044680	missense	probably benign	0.44
R1080:4932438A13Rik	UTSW	3	36988255	missense	probably damaging	1.00
R1103:4932438A13Rik	UTSW	3	36996523	missense	probably benign
R1119:4932438A13Rik	UTSW	3	36987045	missense	probably damaging	1.00
R1170:4932438A13Rik	UTSW	3	37044631	missense	probably damaging	0.98
R1183:4932438A13Rik	UTSW	3	36895303	missense	possibly damaging	0.51
R1186:4932438A13Rik	UTSW	3	36996312	unclassified	probably benign
R1201:4932438A13Rik	UTSW	3	36948375	missense	probably benign
R1219:4932438A13Rik	UTSW	3	36946470	nonsense	probably null
R1270:4932438A13Rik	UTSW	3	36952184	missense	probably damaging	1.00
R1273:4932438A13Rik	UTSW	3	36987210	missense	probably damaging	1.00
R1338:4932438A13Rik	UTSW	3	37052535	missense	unknown
R1364:4932438A13Rik	UTSW	3	36987030	missense	probably damaging	1.00
R1437:4932438A13Rik	UTSW	3	36942429	missense	possibly damaging	0.65
R1447:4932438A13Rik	UTSW	3	36965586	missense	probably damaging	0.98
R1467:4932438A13Rik	UTSW	3	37035945	missense	probably damaging	0.99
R1467:4932438A13Rik	UTSW	3	37035945	missense	probably damaging	0.99
R1470:4932438A13Rik	UTSW	3	36998331	missense	probably benign	0.31
R1470:4932438A13Rik	UTSW	3	36998331	missense	probably benign	0.31
R1481:4932438A13Rik	UTSW	3	37008434	missense	probably damaging	0.99
R1528:4932438A13Rik	UTSW	3	37052535	missense	unknown
R1533:4932438A13Rik	UTSW	3	37041375	missense	probably damaging	1.00
R1546:4932438A13Rik	UTSW	3	36870056	missense	possibly damaging	0.64
R1606:4932438A13Rik	UTSW	3	36942399	missense	probably damaging	1.00
R1638:4932438A13Rik	UTSW	3	37035812	nonsense	probably null
R1772:4932438A13Rik	UTSW	3	36959432	missense	probably damaging	1.00
R1896:4932438A13Rik	UTSW	3	36908231	nonsense	probably null
R1983:4932438A13Rik	UTSW	3	36887865	missense	probably null	1.00
R1987:4932438A13Rik	UTSW	3	36953985	critical splice donor site	probably null
R1992:4932438A13Rik	UTSW	3	37000032	missense	probably benign	0.32
R1999:4932438A13Rik	UTSW	3	36908211	missense	probably damaging	1.00
R2004:4932438A13Rik	UTSW	3	36895378	missense	possibly damaging	0.77
R2010:4932438A13Rik	UTSW	3	36928551	missense	probably benign	0.09
R2027:4932438A13Rik	UTSW	3	37047961	splice site	probably benign
R2039:4932438A13Rik	UTSW	3	37003878	missense	possibly damaging	0.66
R2054:4932438A13Rik	UTSW	3	36947853	missense	probably benign	0.01
R2089:4932438A13Rik	UTSW	3	36988256	missense	probably damaging	1.00
R2091:4932438A13Rik	UTSW	3	36988256	missense	probably damaging	1.00
R2091:4932438A13Rik	UTSW	3	36953970	missense	probably damaging	1.00
R2091:4932438A13Rik	UTSW	3	36988256	missense	probably damaging	1.00
R2220:4932438A13Rik	UTSW	3	36875530	critical splice donor site	probably null
R2374:4932438A13Rik	UTSW	3	36885396	missense	probably benign	0.00
R2437:4932438A13Rik	UTSW	3	36958685	splice site	probably null
R2860:4932438A13Rik	UTSW	3	36965849	missense	probably damaging	1.00
R2861:4932438A13Rik	UTSW	3	36965849	missense	probably damaging	1.00
R2909:4932438A13Rik	UTSW	3	36947953	missense	probably damaging	1.00
R2925:4932438A13Rik	UTSW	3	37007122	missense	probably damaging	0.99
R2940:4932438A13Rik	UTSW	3	36958805	missense	probably damaging	1.00
R3015:4932438A13Rik	UTSW	3	36875462	missense	probably damaging	1.00
R3086:4932438A13Rik	UTSW	3	37011703	missense	possibly damaging	0.56
R3159:4932438A13Rik	UTSW	3	36959415	missense	probably benign	0.17
R3440:4932438A13Rik	UTSW	3	37041912	nonsense	probably null
R3703:4932438A13Rik	UTSW	3	36987581	missense	probably damaging	1.00
R3705:4932438A13Rik	UTSW	3	36987581	missense	probably damaging	1.00
R3795:4932438A13Rik	UTSW	3	37030565	missense	probably benign	0.30
R3820:4932438A13Rik	UTSW	3	37040434	missense	probably damaging	1.00
R3862:4932438A13Rik	UTSW	3	36885398	missense	possibly damaging	0.73
R3944:4932438A13Rik	UTSW	3	37030061	missense	possibly damaging	0.90
R4020:4932438A13Rik	UTSW	3	37012575	intron	probably benign
R4091:4932438A13Rik	UTSW	3	37030589	missense	probably benign	0.00
R4159:4932438A13Rik	UTSW	3	36931083	missense	probably benign	0.00
R4231:4932438A13Rik	UTSW	3	36920236	missense	probably benign	0.10
R4368:4932438A13Rik	UTSW	3	36988147	nonsense	probably null
R4413:4932438A13Rik	UTSW	3	36958681	splice site	probably null
R4475:4932438A13Rik	UTSW	3	37040395	missense	probably damaging	1.00
R4488:4932438A13Rik	UTSW	3	37003933	missense	probably null	0.93
R4489:4932438A13Rik	UTSW	3	37003933	missense	probably null	0.93
R4516:4932438A13Rik	UTSW	3	36895311	missense	possibly damaging	0.90
R4580:4932438A13Rik	UTSW	3	37030025	missense	probably benign	0.02
R4672:4932438A13Rik	UTSW	3	36889990	makesense	probably null
R4705:4932438A13Rik	UTSW	3	37041889	missense	probably benign	0.03
R4735:4932438A13Rik	UTSW	3	37004967	missense	possibly damaging	0.84
R4741:4932438A13Rik	UTSW	3	36942375	missense	probably damaging	0.99
R4754:4932438A13Rik	UTSW	3	37022466	nonsense	probably null
R4778:4932438A13Rik	UTSW	3	36937065	missense	possibly damaging	0.90
R4833:4932438A13Rik	UTSW	3	36964968	missense	probably damaging	0.96
R4896:4932438A13Rik	UTSW	3	36965937	missense	probably damaging	1.00
R4910:4932438A13Rik	UTSW	3	36998199	missense	probably damaging	1.00
R4922:4932438A13Rik	UTSW	3	36987165	missense	probably damaging	1.00
R4941:4932438A13Rik	UTSW	3	36917702	missense	probably damaging	1.00
R4941:4932438A13Rik	UTSW	3	36919901	missense	probably benign	0.41
R4980:4932438A13Rik	UTSW	3	36943312	missense	probably damaging	1.00
R5030:4932438A13Rik	UTSW	3	36943399	intron	probably benign
R5049:4932438A13Rik	UTSW	3	37040506	intron	probably benign
R5049:4932438A13Rik	UTSW	3	37041390	missense	probably damaging	1.00
R5089:4932438A13Rik	UTSW	3	36987502	missense	probably benign	0.02
R5092:4932438A13Rik	UTSW	3	37000085	missense	probably benign	0.14
R5122:4932438A13Rik	UTSW	3	37034757	splice site	probably null
R5210:4932438A13Rik	UTSW	3	37033265	missense	possibly damaging	0.85
R5246:4932438A13Rik	UTSW	3	37048050	missense	probably damaging	1.00
R5289:4932438A13Rik	UTSW	3	37000109	missense	probably damaging	0.97
R5348:4932438A13Rik	UTSW	3	37048146	missense	probably damaging	1.00
R5394:4932438A13Rik	UTSW	3	36917668	missense	probably damaging	1.00
R5434:4932438A13Rik	UTSW	3	36875516	missense	probably damaging	1.00
R5667:4932438A13Rik	UTSW	3	36917677	missense	probably benign	0.00
R5686:4932438A13Rik	UTSW	3	36917660	missense	probably benign	0.00
R5701:4932438A13Rik	UTSW	3	36921360	missense	probably benign	0.10
R5778:4932438A13Rik	UTSW	3	36958714	missense	probably damaging	1.00
R5787:4932438A13Rik	UTSW	3	36992733	splice site	probably null
R5800:4932438A13Rik	UTSW	3	37052443	missense	probably damaging	1.00
R5819:4932438A13Rik	UTSW	3	37048600	missense	probably benign	0.12
R5820:4932438A13Rik	UTSW	3	37039526	missense	probably benign	0.00
R5952:4932438A13Rik	UTSW	3	36965621	missense	probably damaging	1.00
R5975:4932438A13Rik	UTSW	3	36969221	missense	possibly damaging	0.64
R5996:4932438A13Rik	UTSW	3	36931116	missense	probably benign	0.07
R6192:4932438A13Rik	UTSW	3	36988169	missense	probably benign	0.00
R6225:4932438A13Rik	UTSW	3	36948304	missense	probably damaging	1.00
R6234:4932438A13Rik	UTSW	3	36983471	missense	probably benign	0.00
R6244:4932438A13Rik	UTSW	3	36956999	missense	probably benign
R6263:4932438A13Rik	UTSW	3	36931111	missense	probably benign	0.06
R6351:4932438A13Rik	UTSW	3	36908228	missense	probably damaging	1.00
R6380:4932438A13Rik	UTSW	3	37033307	missense	probably benign	0.19
R6468:4932438A13Rik	UTSW	3	37008443	missense	probably damaging	1.00
R6759:4932438A13Rik	UTSW	3	36988085	missense	possibly damaging	0.81
R6792:4932438A13Rik	UTSW	3	37011566	critical splice acceptor site	probably null
R6809:4932438A13Rik	UTSW	3	36874282	missense	probably damaging	0.98
R6841:4932438A13Rik	UTSW	3	37021481	missense	probably damaging	1.00
R6959:4932438A13Rik	UTSW	3	36967189	missense	probably damaging	1.00
R7102:4932438A13Rik	UTSW	3	36940798	missense	probably damaging	0.99
R7188:4932438A13Rik	UTSW	3	36950013	missense	probably benign	0.06
R7212:4932438A13Rik	UTSW	3	37048009	missense
R7425:4932438A13Rik	UTSW	3	36948341	missense	probably benign
R7425:4932438A13Rik	UTSW	3	36983394	missense	probably benign	0.02
R7451:4932438A13Rik	UTSW	3	37022807	splice site	probably null
R7604:4932438A13Rik	UTSW	3	36949843	splice site	probably null
R7622:4932438A13Rik	UTSW	3	36948413	nonsense	probably null
R7671:4932438A13Rik	UTSW	3	36943231	missense	probably damaging	0.99
R7699:4932438A13Rik	UTSW	3	36974172	missense	possibly damaging	0.67
R7699:4932438A13Rik	UTSW	3	37026154	missense	probably benign	0.00
R7700:4932438A13Rik	UTSW	3	36974172	missense	possibly damaging	0.67
R7700:4932438A13Rik	UTSW	3	37026154	missense	probably benign	0.00
R7748:4932438A13Rik	UTSW	3	36959335	critical splice acceptor site	probably null
R7767:4932438A13Rik	UTSW	3	36920287	critical splice donor site	probably null
R7787:4932438A13Rik	UTSW	3	36885408	missense	probably damaging	1.00
R7830:4932438A13Rik	UTSW	3	36964932	frame shift	probably null
R7849:4932438A13Rik	UTSW	3	37026328	missense
R7912:4932438A13Rik	UTSW	3	37007069	missense	probably damaging	0.99
R7914:4932438A13Rik	UTSW	3	36946283	missense	probably benign	0.13
R7945:4932438A13Rik	UTSW	3	36965893	missense	probably benign	0.03
R8039:4932438A13Rik	UTSW	3	36943214	missense	probably benign	0.12
R8101:4932438A13Rik	UTSW	3	37008502	missense	probably damaging	1.00
R8143:4932438A13Rik	UTSW	3	36946508	critical splice donor site	probably null
R8145:4932438A13Rik	UTSW	3	36998267	missense	probably damaging	1.00
R8171:4932438A13Rik	UTSW	3	36975713	missense	probably benign	0.00
R8210:4932438A13Rik	UTSW	3	37012881	missense
R8250:4932438A13Rik	UTSW	3	36917662	missense	probably damaging	0.99
R8369:4932438A13Rik	UTSW	3	37011603	missense
R8478:4932438A13Rik	UTSW	3	37033277	missense	possibly damaging	0.74
R8558:4932438A13Rik	UTSW	3	37048601	missense
R8688:4932438A13Rik	UTSW	3	37035917	missense
R8724:4932438A13Rik	UTSW	3	36890893	missense	probably damaging	0.99
R8818:4932438A13Rik	UTSW	3	36996548	missense	possibly damaging	0.60
R8869:4932438A13Rik	UTSW	3	36958858	missense	probably damaging	0.99
R8887:4932438A13Rik	UTSW	3	37033354	missense	possibly damaging	0.95
R8899:4932438A13Rik	UTSW	3	36988280	missense	probably damaging	1.00
R8907:4932438A13Rik	UTSW	3	36948146	nonsense	probably null
R8960:4932438A13Rik	UTSW	3	37012983	missense	probably damaging	1.00
R8990:4932438A13Rik	UTSW	3	36921221	missense	possibly damaging	0.60
R9021:4932438A13Rik	UTSW	3	36998344	missense	probably benign	0.00
R9048:4932438A13Rik	UTSW	3	37011777	missense
R9100:4932438A13Rik	UTSW	3	37044758	missense
R9166:4932438A13Rik	UTSW	3	36987367	missense	probably damaging	1.00
R9176:4932438A13Rik	UTSW	3	36956703	missense	possibly damaging	0.82
R9202:4932438A13Rik	UTSW	3	36890821	missense	probably benign
R9303:4932438A13Rik	UTSW	3	37044820	missense
R9305:4932438A13Rik	UTSW	3	37044820	missense
R9332:4932438A13Rik	UTSW	3	37050840	missense
R9362:4932438A13Rik	UTSW	3	36957013	missense	probably benign
R9493:4932438A13Rik	UTSW	3	37011736	missense
R9534:4932438A13Rik	UTSW	3	36998270	missense	probably benign	0.01
R9569:4932438A13Rik	UTSW	3	37012621	missense
R9593:4932438A13Rik	UTSW	3	36947941	missense	probably damaging	1.00
R9600:4932438A13Rik	UTSW	3	37041416	nonsense	probably null
R9733:4932438A13Rik	UTSW	3	37048583	missense
R9751:4932438A13Rik	UTSW	3	37011740	missense
RF013:4932438A13Rik	UTSW	3	37050757	critical splice acceptor site	probably benign
RF015:4932438A13Rik	UTSW	3	37050748	critical splice acceptor site	probably benign
RF021:4932438A13Rik	UTSW	3	37050748	critical splice acceptor site	probably benign
RF023:4932438A13Rik	UTSW	3	37050760	critical splice acceptor site	probably benign
RF034:4932438A13Rik	UTSW	3	37050760	critical splice acceptor site	probably benign
RF035:4932438A13Rik	UTSW	3	37050758	critical splice acceptor site	probably benign
RF055:4932438A13Rik	UTSW	3	37050757	critical splice acceptor site	probably benign
X0050:4932438A13Rik	UTSW	3	36957128	missense	probably damaging	1.00
Z1088:4932438A13Rik	UTSW	3	36987567	missense	probably damaging	1.00
Z1177:4932438A13Rik	UTSW	3	36919950	missense	probably benign
Z1177:4932438A13Rik	UTSW	3	36983440	missense	possibly damaging	0.88
Z1177:4932438A13Rik	UTSW	3	37036707	missense

Predicted Primers

PCR Primer
(F):5'- CTAGACAGTTGCTTGCTTTCTG -3'
(R):5'- TTCACAGTTAGCTGGAGGAAG -3'

Sequencing Primer
(F):5'- ACAGTTGCTTGCTTTCTGTTTCTTTC -3'
(R):5'- GAGAGTCCCAAAGGCCTGG -3'

Posted On

2014-07-14