Mutagenetix > Incidental Mutation

Incidental Mutation 'R1919:Rasef'

212826

Institutional Source

Beutler Lab

Gene Symbol

Rasef

Ensembl Gene

ENSMUSG00000043003

Gene Name

RAS and EF hand domain containing

Synonyms

RAB45

MMRRC Submission

039937-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.082) question?

Stock #

R1919 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

73714579-73790994 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 73744114 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 200 (S200P)

Ref Sequence

ENSEMBL: ENSMUSP00000099901 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058292] [ENSMUST00000102837] [ENSMUST00000222414]

AlphaFold

Q5RI75

Predicted Effect

possibly damaging
Transcript: ENSMUST00000058292
AA Change: S272P

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000062771
Gene: ENSMUSG00000043003
AA Change: S272P

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
coiled coil region	55	251	N/A	INTRINSIC
RAB	429	598	4.94e-69	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102837
AA Change: S200P

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000099901
Gene: ENSMUSG00000043003
AA Change: S200P

Domain	Start	End	E-Value	Type
coiled coil region	5	179	N/A	INTRINSIC
RAB	357	526	4.94e-69	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000222414
AA Change: S353P

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

Meta Mutation Damage Score

0.0585

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.7%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Rab family of GTPases that are involved in regulation of membrane traffic. The encoded protein contains an N-terminal EF-hand domain, a coiled-coil motif and a C-terminal Rab domain. A potential role as tumor suppressor has been indicated for this gene. [provided by RefSeq, Nov 2012]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,067,270	E740G	probably damaging	Het
4930474N05Rik	G	T	14: 36,095,457	V105F	possibly damaging	Het
4932438A13Rik	A	G	3: 37,006,983		probably null	Het
Actr10	A	G	12: 70,942,330	I74M	probably benign	Het
Aen	T	C	7: 78,905,912	Y108H	probably damaging	Het
Afm	A	T	5: 90,524,920	K205*	probably null	Het
Ankrd27	T	A	7: 35,632,985	S846T	probably benign	Het
Ano3	A	G	2: 110,885,007	S29P	probably benign	Het
Apaf1	C	T	10: 91,077,614	W138*	probably null	Het
Arfgef1	C	T	1: 10,199,878	A349T	probably benign	Het
Arhgef4	A	G	1: 34,811,140	Q1798R	probably damaging	Het
Astn1	G	A	1: 158,509,971	V416I	probably damaging	Het
Atxn2l	G	A	7: 126,493,168	T70I	probably damaging	Het
Auh	G	A	13: 52,835,496	P308L	probably benign	Het
Bspry	T	A	4: 62,494,797	C256S	probably damaging	Het
C3	C	A	17: 57,220,135	W771C	probably damaging	Het
Camkv	A	G	9: 107,947,088	D233G	possibly damaging	Het
Catsperd	T	A	17: 56,635,548	V109E	probably damaging	Het
Cd101	A	G	3: 101,018,917	L162P	probably damaging	Het
Cdr2l	A	G	11: 115,392,777	T154A	probably damaging	Het
Clca3a2	G	C	3: 144,810,696	Q380E	probably benign	Het
Col6a3	T	C	1: 90,822,359	N251S	possibly damaging	Het
Cttnbp2nl	A	G	3: 105,011,278	V82A	possibly damaging	Het
Cux1	G	A	5: 136,363,319	Q194*	probably null	Het
Daam2	T	C	17: 49,485,457	E361G	probably benign	Het
Dcaf17	A	T	2: 71,078,172		probably null	Het
Dnaic1	T	C	4: 41,570,020		probably null	Het
Eml5	T	C	12: 98,798,839	Y1617C	probably damaging	Het
Epb41l4b	T	C	4: 57,040,993	E490G	probably damaging	Het
Epha7	T	C	4: 28,963,969	M988T	possibly damaging	Het
Fancm	T	C	12: 65,105,520	C917R	possibly damaging	Het
Fnip1	C	T	11: 54,480,684	T177I	probably damaging	Het
Gm12169	A	G	11: 46,528,531	D58G	possibly damaging	Het
Gm3604	G	T	13: 62,369,942	H201N	probably benign	Het
Gnpda1	T	C	18: 38,333,190		probably null	Het
Gpatch8	A	G	11: 102,508,142		probably null	Het
H2-M3	T	C	17: 37,271,189	Y179H	possibly damaging	Het
H2-Q10	C	A	17: 35,470,488	S62R	probably damaging	Het
Hipk2	G	A	6: 38,818,984	R117*	probably null	Het
Hrg	A	T	16: 22,954,457	Q113H	probably damaging	Het
Kcnj16	T	C	11: 111,024,953	V147A	possibly damaging	Het
Kif1a	T	C	1: 93,019,031	I1650V	possibly damaging	Het
Kmt2a	C	T	9: 44,820,345		probably benign	Het
Krt90	A	T	15: 101,557,230	Y319N	probably damaging	Het
Lipo4	T	C	19: 33,499,271	N359S	possibly damaging	Het
Lrp1b	G	T	2: 41,728,729	T225K	probably benign	Het
Map1a	C	T	2: 121,307,012	P2532S	probably damaging	Het
Mmrn2	A	G	14: 34,397,643	D193G	probably benign	Het
Mpped2	T	A	2: 106,867,032	I284N	probably damaging	Het
Msh6	A	G	17: 87,985,125	H436R	probably benign	Het
Mterf3	A	T	13: 66,930,062	S48T	probably damaging	Het
Muc5b	T	C	7: 141,846,031	F414L	unknown	Het
Mylk4	A	T	13: 32,724,853	D90E	probably benign	Het
Nploc4	A	G	11: 120,404,229	Y420H	probably damaging	Het
Npr2	T	A	4: 43,640,578	Y344N	probably damaging	Het
Nsun5	A	G	5: 135,375,598	T397A	probably benign	Het
Ntsr2	A	T	12: 16,654,110	Q204L	probably damaging	Het
Nwd2	T	A	5: 63,806,180	Y1036N	probably damaging	Het
Oacyl	T	C	18: 65,710,547	V105A	possibly damaging	Het
Olfr791	T	A	10: 129,527,049	V274D	probably damaging	Het
Parp3	T	A	9: 106,475,117	Q70L	possibly damaging	Het
Parp4	T	C	14: 56,624,017	S936P	probably damaging	Het
Pdzd3	T	C	9: 44,250,303	D93G	possibly damaging	Het
Phkb	A	G	8: 85,922,161	E202G	probably benign	Het
Pink1	T	C	4: 138,314,020	N530S	probably benign	Het
Pou3f2	T	C	4: 22,487,119	D338G	probably damaging	Het
Prss8	G	T	7: 127,929,858	L9I	probably benign	Het
Ptpn22	G	A	3: 103,876,738		probably null	Het
Rad54b	A	C	4: 11,601,693	N416T	probably damaging	Het
Rb1	T	A	14: 73,212,990	K645*	probably null	Het
Robo2	C	T	16: 73,899,154	G1367D	probably benign	Het
Rp1	A	G	1: 4,352,671	V52A	probably damaging	Het
Samd13	T	C	3: 146,662,712	T23A	probably benign	Het
Scn7a	T	C	2: 66,699,973	H676R	probably damaging	Het
Serpinb6b	A	G	13: 32,978,240	I222V	probably benign	Het
Slc2a8	T	C	2: 32,980,079	Y150C	probably damaging	Het
Slc7a6os	C	A	8: 106,210,564	R88L	probably damaging	Het
Slc8a2	A	G	7: 16,152,920	I657V	probably benign	Het
Slit2	C	A	5: 48,191,016		probably benign	Het
Spire2	A	G	8: 123,363,071	D447G	probably benign	Het
Sptlc3	A	G	2: 139,566,675	N237D	possibly damaging	Het
Stk3	G	A	15: 35,073,217	T119I	probably damaging	Het
Suv39h2	G	A	2: 3,464,316	T334I	probably damaging	Het
Syt5	G	T	7: 4,540,279	T327N	probably damaging	Het
Tcof1	T	C	18: 60,816,084	D1253G	possibly damaging	Het
Tnks	A	T	8: 34,875,232	V388D	probably damaging	Het
Ugt2b1	T	C	5: 86,926,000	T167A	probably benign	Het
Usp40	G	A	1: 87,995,842	R236C	possibly damaging	Het
Utrn	T	C	10: 12,455,480	D2904G	probably benign	Het
Vmn1r226	T	C	17: 20,687,580	S25P	probably damaging	Het
Vmn2r23	T	C	6: 123,713,010	S282P	possibly damaging	Het
Vps45	T	C	3: 96,046,440	E200G	probably benign	Het
Wnt7b	T	A	15: 85,559,080	I41F	probably damaging	Het
Zmym6	T	A	4: 127,103,414	N275K	probably damaging	Het

Other mutations in Rasef

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Rasef	APN	4	73771425	nonsense	probably null
IGL01329:Rasef	APN	4	73727645	missense	probably damaging	1.00
IGL01517:Rasef	APN	4	73769822	missense	probably benign	0.03
IGL02465:Rasef	APN	4	73734488	missense	probably damaging	1.00
IGL02676:Rasef	APN	4	73759729	missense	possibly damaging	0.69
IGL03137:Rasef	APN	4	73734483	nonsense	probably null
IGL03403:Rasef	APN	4	73734534	missense	probably damaging	1.00
BB001:Rasef	UTSW	4	73740929	critical splice donor site	probably null
BB011:Rasef	UTSW	4	73740929	critical splice donor site	probably null
P0033:Rasef	UTSW	4	73749852	missense	probably benign	0.26
R0035:Rasef	UTSW	4	73762854	splice site	probably benign
R0035:Rasef	UTSW	4	73762854	splice site	probably benign
R0317:Rasef	UTSW	4	73748562	missense	probably damaging	1.00
R0686:Rasef	UTSW	4	73734534	missense	probably damaging	1.00
R0987:Rasef	UTSW	4	73734484	nonsense	probably null
R1115:Rasef	UTSW	4	73748604	missense	possibly damaging	0.85
R1511:Rasef	UTSW	4	73735748	missense	probably damaging	1.00
R1585:Rasef	UTSW	4	73740337	missense	probably damaging	1.00
R1646:Rasef	UTSW	4	73734549	missense	probably damaging	1.00
R1705:Rasef	UTSW	4	73744064	nonsense	probably null
R1918:Rasef	UTSW	4	73744114	missense	possibly damaging	0.94
R3819:Rasef	UTSW	4	73759705	missense	probably damaging	1.00
R3891:Rasef	UTSW	4	73780397	missense	probably benign	0.03
R3892:Rasef	UTSW	4	73780397	missense	probably benign	0.03
R4344:Rasef	UTSW	4	73745089	missense	probably damaging	1.00
R4491:Rasef	UTSW	4	73734503	missense	probably damaging	1.00
R4492:Rasef	UTSW	4	73734503	missense	probably damaging	1.00
R4594:Rasef	UTSW	4	73780389	missense	possibly damaging	0.47
R4915:Rasef	UTSW	4	73731459	missense	probably damaging	1.00
R5276:Rasef	UTSW	4	73735767	missense	probably null	1.00
R5359:Rasef	UTSW	4	73771328	missense	probably damaging	1.00
R5682:Rasef	UTSW	4	73740971	nonsense	probably null
R5693:Rasef	UTSW	4	73769839	missense	probably damaging	0.99
R6414:Rasef	UTSW	4	73740581	missense	probably benign	0.13
R6543:Rasef	UTSW	4	73780519	intron	probably benign
R6593:Rasef	UTSW	4	73745090	missense	probably damaging	1.00
R7078:Rasef	UTSW	4	73780389	missense	probably benign	0.01
R7083:Rasef	UTSW	4	73790984	missense	probably benign	0.26
R7106:Rasef	UTSW	4	73727627	missense	probably damaging	1.00
R7127:Rasef	UTSW	4	73744132	missense	probably damaging	1.00
R7329:Rasef	UTSW	4	73744137	missense	probably damaging	1.00
R7767:Rasef	UTSW	4	73734534	missense	probably damaging	1.00
R7891:Rasef	UTSW	4	73759698	missense	probably benign	0.00
R7891:Rasef	UTSW	4	73790964	missense	probably benign
R7924:Rasef	UTSW	4	73740929	critical splice donor site	probably null
R7997:Rasef	UTSW	4	73740562	missense	possibly damaging	0.78
R8554:Rasef	UTSW	4	73727607	missense	probably benign	0.03
R8832:Rasef	UTSW	4	73780321	intron	probably benign
R8850:Rasef	UTSW	4	73727603	missense	probably damaging	1.00
R8985:Rasef	UTSW	4	73790723	missense	possibly damaging	0.48
R9093:Rasef	UTSW	4	73780346	missense	probably benign	0.00
R9179:Rasef	UTSW	4	73744119	missense	probably damaging	0.97
R9199:Rasef	UTSW	4	73740388	missense	possibly damaging	0.88
R9300:Rasef	UTSW	4	73741156	missense	probably benign
R9310:Rasef	UTSW	4	73735719	critical splice donor site	probably null
R9415:Rasef	UTSW	4	73727645	missense	probably benign	0.00
R9482:Rasef	UTSW	4	73790696	missense	probably benign	0.00
R9719:Rasef	UTSW	4	73769865	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- TAATGCAACAGCACAGGACG -3'
(R):5'- CCAGGTCTGTTATGCTTCCTGG -3'

Sequencing Primer
(F):5'- GGCATGGATTGACATACACAAAATC -3'
(R):5'- GCTTCCTGGAACTTTCAAAATGATG -3'

Posted On

2014-07-14