Incidental Mutation 'R1919:Parp3'
List |< first << previous [record 61 of 95] next >> last >|
ID212853
Institutional Source Beutler Lab
Gene Symbol Parp3
Ensembl Gene ENSMUSG00000023249
Gene Namepoly (ADP-ribose) polymerase family, member 3
SynonymsA930002C11Rik, PARP-3, Adprt3, Adprtl3
MMRRC Submission 039937-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1919 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location106470322-106476949 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106475117 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 70 (Q70L)
Ref Sequence ENSEMBL: ENSMUSP00000117329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047721] [ENSMUST00000067218] [ENSMUST00000112479] [ENSMUST00000123555] [ENSMUST00000125850] [ENSMUST00000156426] [ENSMUST00000214682]
Predicted Effect probably benign
Transcript: ENSMUST00000047721
SMART Domains Protein: ENSMUSP00000038580
Gene: ENSMUSG00000041506

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
low complexity region 47 57 N/A INTRINSIC
coiled coil region 61 102 N/A INTRINSIC
WD40 135 174 1.15e-4 SMART
WD40 177 227 3.09e-5 SMART
WD40 230 269 2.42e-7 SMART
WD40 272 311 9.24e-4 SMART
WD40 313 351 2.4e-2 SMART
WD40 354 404 4.6e0 SMART
Blast:WD40 412 451 1e-15 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000067218
AA Change: Q70L

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000064513
Gene: ENSMUSG00000023249
AA Change: Q70L

DomainStartEndE-ValueType
WGR 64 141 1.83e-37 SMART
Pfam:PARP_reg 176 315 8.7e-39 PFAM
Pfam:PARP 317 528 7.1e-62 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112479
AA Change: Q70L

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108098
Gene: ENSMUSG00000023249
AA Change: Q70L

DomainStartEndE-ValueType
WGR 64 141 1.83e-37 SMART
Pfam:PARP_reg 182 319 1.3e-42 PFAM
Pfam:PARP 322 533 7.3e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123464
Predicted Effect possibly damaging
Transcript: ENSMUST00000123555
AA Change: Q70L

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123054
Gene: ENSMUSG00000023249
AA Change: Q70L

DomainStartEndE-ValueType
WGR 64 141 1.83e-37 SMART
Pfam:PARP_reg 176 315 8.7e-39 PFAM
Pfam:PARP 317 528 7.1e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125630
Predicted Effect possibly damaging
Transcript: ENSMUST00000125850
AA Change: Q70L

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119244
Gene: ENSMUSG00000023249
AA Change: Q70L

DomainStartEndE-ValueType
WGR 64 141 1.83e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145396
Predicted Effect possibly damaging
Transcript: ENSMUST00000156426
AA Change: Q70L

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117329
Gene: ENSMUSG00000023249
AA Change: Q70L

DomainStartEndE-ValueType
WGR 64 141 1.83e-37 SMART
PDB:4L7U|A 179 202 6e-7 PDB
SCOP:d1a26_1 182 202 5e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000214682
AA Change: Q70L

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217303
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PARP family. These enzymes modify nuclear proteins by poly-ADP-ribosylation, which is required for DNA repair, regulation of apoptosis, and maintenance of genomic stability. This gene encodes the poly(ADP-ribosyl)transferase 3, which is preferentially localized to the daughter centriole throughout the cell cycle. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,270 E740G probably damaging Het
4930474N05Rik G T 14: 36,095,457 V105F possibly damaging Het
4932438A13Rik A G 3: 37,006,983 probably null Het
Actr10 A G 12: 70,942,330 I74M probably benign Het
Aen T C 7: 78,905,912 Y108H probably damaging Het
Afm A T 5: 90,524,920 K205* probably null Het
Ankrd27 T A 7: 35,632,985 S846T probably benign Het
Ano3 A G 2: 110,885,007 S29P probably benign Het
Apaf1 C T 10: 91,077,614 W138* probably null Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgef4 A G 1: 34,811,140 Q1798R probably damaging Het
Astn1 G A 1: 158,509,971 V416I probably damaging Het
Atxn2l G A 7: 126,493,168 T70I probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bspry T A 4: 62,494,797 C256S probably damaging Het
C3 C A 17: 57,220,135 W771C probably damaging Het
Camkv A G 9: 107,947,088 D233G possibly damaging Het
Catsperd T A 17: 56,635,548 V109E probably damaging Het
Cd101 A G 3: 101,018,917 L162P probably damaging Het
Cdr2l A G 11: 115,392,777 T154A probably damaging Het
Clca3a2 G C 3: 144,810,696 Q380E probably benign Het
Col6a3 T C 1: 90,822,359 N251S possibly damaging Het
Cttnbp2nl A G 3: 105,011,278 V82A possibly damaging Het
Cux1 G A 5: 136,363,319 Q194* probably null Het
Daam2 T C 17: 49,485,457 E361G probably benign Het
Dcaf17 A T 2: 71,078,172 probably null Het
Dnaic1 T C 4: 41,570,020 probably null Het
Eml5 T C 12: 98,798,839 Y1617C probably damaging Het
Epb41l4b T C 4: 57,040,993 E490G probably damaging Het
Epha7 T C 4: 28,963,969 M988T possibly damaging Het
Fancm T C 12: 65,105,520 C917R possibly damaging Het
Fnip1 C T 11: 54,480,684 T177I probably damaging Het
Gm12169 A G 11: 46,528,531 D58G possibly damaging Het
Gm3604 G T 13: 62,369,942 H201N probably benign Het
Gnpda1 T C 18: 38,333,190 probably null Het
Gpatch8 A G 11: 102,508,142 probably null Het
H2-M3 T C 17: 37,271,189 Y179H possibly damaging Het
H2-Q10 C A 17: 35,470,488 S62R probably damaging Het
Hipk2 G A 6: 38,818,984 R117* probably null Het
Hrg A T 16: 22,954,457 Q113H probably damaging Het
Kcnj16 T C 11: 111,024,953 V147A possibly damaging Het
Kif1a T C 1: 93,019,031 I1650V possibly damaging Het
Kmt2a C T 9: 44,820,345 probably benign Het
Krt90 A T 15: 101,557,230 Y319N probably damaging Het
Lipo4 T C 19: 33,499,271 N359S possibly damaging Het
Lrp1b G T 2: 41,728,729 T225K probably benign Het
Map1a C T 2: 121,307,012 P2532S probably damaging Het
Mmrn2 A G 14: 34,397,643 D193G probably benign Het
Mpped2 T A 2: 106,867,032 I284N probably damaging Het
Msh6 A G 17: 87,985,125 H436R probably benign Het
Mterf3 A T 13: 66,930,062 S48T probably damaging Het
Muc5b T C 7: 141,846,031 F414L unknown Het
Mylk4 A T 13: 32,724,853 D90E probably benign Het
Nploc4 A G 11: 120,404,229 Y420H probably damaging Het
Npr2 T A 4: 43,640,578 Y344N probably damaging Het
Nsun5 A G 5: 135,375,598 T397A probably benign Het
Ntsr2 A T 12: 16,654,110 Q204L probably damaging Het
Nwd2 T A 5: 63,806,180 Y1036N probably damaging Het
Oacyl T C 18: 65,710,547 V105A possibly damaging Het
Olfr791 T A 10: 129,527,049 V274D probably damaging Het
Parp4 T C 14: 56,624,017 S936P probably damaging Het
Pdzd3 T C 9: 44,250,303 D93G possibly damaging Het
Phkb A G 8: 85,922,161 E202G probably benign Het
Pink1 T C 4: 138,314,020 N530S probably benign Het
Pou3f2 T C 4: 22,487,119 D338G probably damaging Het
Prss8 G T 7: 127,929,858 L9I probably benign Het
Ptpn22 G A 3: 103,876,738 probably null Het
Rad54b A C 4: 11,601,693 N416T probably damaging Het
Rasef A G 4: 73,744,114 S200P possibly damaging Het
Rb1 T A 14: 73,212,990 K645* probably null Het
Robo2 C T 16: 73,899,154 G1367D probably benign Het
Rp1 A G 1: 4,352,671 V52A probably damaging Het
Samd13 T C 3: 146,662,712 T23A probably benign Het
Scn7a T C 2: 66,699,973 H676R probably damaging Het
Serpinb6b A G 13: 32,978,240 I222V probably benign Het
Slc2a8 T C 2: 32,980,079 Y150C probably damaging Het
Slc7a6os C A 8: 106,210,564 R88L probably damaging Het
Slc8a2 A G 7: 16,152,920 I657V probably benign Het
Slit2 C A 5: 48,191,016 probably benign Het
Spire2 A G 8: 123,363,071 D447G probably benign Het
Sptlc3 A G 2: 139,566,675 N237D possibly damaging Het
Stk3 G A 15: 35,073,217 T119I probably damaging Het
Suv39h2 G A 2: 3,464,316 T334I probably damaging Het
Syt5 G T 7: 4,540,279 T327N probably damaging Het
Tcof1 T C 18: 60,816,084 D1253G possibly damaging Het
Tnks A T 8: 34,875,232 V388D probably damaging Het
Ugt2b1 T C 5: 86,926,000 T167A probably benign Het
Usp40 G A 1: 87,995,842 R236C possibly damaging Het
Utrn T C 10: 12,455,480 D2904G probably benign Het
Vmn1r226 T C 17: 20,687,580 S25P probably damaging Het
Vmn2r23 T C 6: 123,713,010 S282P possibly damaging Het
Vps45 T C 3: 96,046,440 E200G probably benign Het
Wnt7b T A 15: 85,559,080 I41F probably damaging Het
Zmym6 T A 4: 127,103,414 N275K probably damaging Het
Other mutations in Parp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Parp3 APN 9 106471387 missense probably benign
IGL00827:Parp3 APN 9 106474406 missense probably benign 0.17
IGL02683:Parp3 APN 9 106473185 missense possibly damaging 0.84
R0050:Parp3 UTSW 9 106471401 missense possibly damaging 0.81
R0110:Parp3 UTSW 9 106471796 missense possibly damaging 0.81
R0320:Parp3 UTSW 9 106475812 missense possibly damaging 0.76
R0510:Parp3 UTSW 9 106471796 missense possibly damaging 0.81
R0989:Parp3 UTSW 9 106473082 splice site probably null
R1170:Parp3 UTSW 9 106476005 intron probably benign
R1935:Parp3 UTSW 9 106474732 missense probably damaging 1.00
R1936:Parp3 UTSW 9 106474732 missense probably damaging 1.00
R1958:Parp3 UTSW 9 106474822 unclassified probably null
R2188:Parp3 UTSW 9 106475852 missense probably damaging 0.99
R2919:Parp3 UTSW 9 106473725 missense possibly damaging 0.84
R3014:Parp3 UTSW 9 106471315 missense possibly damaging 0.66
R3429:Parp3 UTSW 9 106474723 missense probably damaging 0.99
R3430:Parp3 UTSW 9 106474723 missense probably damaging 0.99
R3618:Parp3 UTSW 9 106475063 missense possibly damaging 0.81
R3980:Parp3 UTSW 9 106474068 missense probably damaging 1.00
R4840:Parp3 UTSW 9 106473109 missense probably damaging 1.00
R5617:Parp3 UTSW 9 106474505 missense possibly damaging 0.75
R6015:Parp3 UTSW 9 106474282 missense possibly damaging 0.72
R6591:Parp3 UTSW 9 106473692 missense probably benign
R6691:Parp3 UTSW 9 106473692 missense probably benign
R7403:Parp3 UTSW 9 106474853 missense probably benign 0.35
R7612:Parp3 UTSW 9 106474194 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGTGTCCACCAGCAAGATTTG -3'
(R):5'- ACAGCAGGGCTTCATCACATC -3'

Sequencing Primer
(F):5'- TGGGCCCTCCAAACAGCTG -3'
(R):5'- GGGCTTCATCACATCCAGTCAG -3'
Posted On2014-07-14