Mutagenetix > Incidental Mutations

Incidental Mutation 'R1919:Apaf1'

212856

Institutional Source

Beutler Lab

Gene Symbol

Apaf1

Ensembl Gene

ENSMUSG00000019979

Gene Name

apoptotic peptidase activating factor 1

Synonyms

Apaf1l, 6230400I06Rik

MMRRC Submission

039937-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1919 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

90989311-91082770 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 91077614 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Stop codon at position 138 (W138*)

Ref Sequence

ENSEMBL: ENSMUSP00000124134 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020157] [ENSMUST00000159110] [ENSMUST00000160788] [ENSMUST00000161987] [ENSMUST00000162618]

AlphaFold

O88879

Predicted Effect

probably null
Transcript: ENSMUST00000020157
AA Change: W149*

SMART Domains

Protein: ENSMUSP00000020157
Gene: ENSMUSG00000019979
AA Change: W149*

Domain	Start	End	E-Value	Type
Pfam:CARD	6	90	7.3e-22	PFAM
Pfam:NB-ARC	129	414	1.7e-77	PFAM
WD40	604	643	1.35e-5	SMART
WD40	646	685	1.04e-11	SMART
WD40	688	729	2.98e-7	SMART
WD40	732	771	9.88e-13	SMART
WD40	780	825	1.28e1	SMART
WD40	828	868	1.43e0	SMART
WD40	871	910	3.24e-8	SMART
WD40	952	989	2.57e0	SMART
WD40	992	1031	1.09e-5	SMART
WD40	1033	1071	2.09e-2	SMART
WD40	1074	1113	2.93e-6	SMART
WD40	1116	1155	8.55e-8	SMART
WD40	1168	1204	4.55e-3	SMART
Blast:WD40	1207	1246	5e-18	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000159110
AA Change: W149*

SMART Domains

Protein: ENSMUSP00000125291
Gene: ENSMUSG00000019979
AA Change: W149*

Domain	Start	End	E-Value	Type
Pfam:CARD	6	90	7.4e-21	PFAM
Pfam:NB-ARC	129	414	6.9e-71	PFAM
WD40	604	643	1.35e-5	SMART
WD40	646	685	1.04e-11	SMART
WD40	688	729	2.98e-7	SMART
WD40	732	771	9.88e-13	SMART
WD40	780	825	1.28e1	SMART
WD40	828	868	1.43e0	SMART
WD40	871	910	3.24e-8	SMART
WD40	952	989	2.57e0	SMART
WD40	992	1031	1.09e-5	SMART
WD40	1033	1071	2.09e-2	SMART
WD40	1074	1113	2.93e-6	SMART
WD40	1116	1155	8.55e-8	SMART
WD40	1168	1204	4.55e-3	SMART
Blast:WD40	1207	1246	5e-18	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000160788
AA Change: W149*

SMART Domains

Protein: ENSMUSP00000124968
Gene: ENSMUSG00000019979
AA Change: W149*

Domain	Start	End	E-Value	Type
Pfam:CARD	6	90	1e-21	PFAM
Pfam:NB-ARC	129	238	6.9e-24	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000161987
AA Change: W149*

SMART Domains

Protein: ENSMUSP00000124422
Gene: ENSMUSG00000019979
AA Change: W149*

Domain	Start	End	E-Value	Type
Pfam:CARD	6	90	1e-21	PFAM
Pfam:NB-ARC	129	238	6.9e-24	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000162618
AA Change: W138*

SMART Domains

Protein: ENSMUSP00000124134
Gene: ENSMUSG00000019979
AA Change: W138*

Domain	Start	End	E-Value	Type
Pfam:CARD	6	90	1.1e-20	PFAM
Pfam:NB-ARC	118	403	8.8e-72	PFAM
WD40	593	632	1.35e-5	SMART
WD40	635	674	1.04e-11	SMART
WD40	677	718	2.98e-7	SMART
WD40	721	760	9.88e-13	SMART
WD40	769	814	1.28e1	SMART
WD40	817	857	1.43e0	SMART
WD40	860	899	3.24e-8	SMART
WD40	941	978	2.57e0	SMART
WD40	981	1020	1.09e-5	SMART
WD40	1022	1060	2.09e-2	SMART
WD40	1063	1102	2.93e-6	SMART
WD40	1105	1144	8.55e-8	SMART
WD40	1157	1193	4.55e-3	SMART
Blast:WD40	1196	1235	5e-18	BLAST

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.7%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that initiates apoptosis. This protein contains several copies of the WD-40 domain, a caspase recruitment domain (CARD), and an ATPase domain (NB-ARC). Upon binding cytochrome c and dATP, this protein forms an oligomeric apoptosome. The apoptosome binds and cleaves caspase 9 preproprotein, releasing its mature, activated form. Activated caspase 9 stimulates the subsequent caspase cascade that commits the cell to apoptosis. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations have defects in apoptosis resulting in brain overgrowth, craniofacial defects, interdigit webbing and altered lens and retina. Most mutants die by embryonic day 16.5 or perinatally, and male survivors are sterile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,067,270	E740G	probably damaging	Het
4930474N05Rik	G	T	14: 36,095,457	V105F	possibly damaging	Het
4932438A13Rik	A	G	3: 37,006,983		probably null	Het
Actr10	A	G	12: 70,942,330	I74M	probably benign	Het
Aen	T	C	7: 78,905,912	Y108H	probably damaging	Het
Afm	A	T	5: 90,524,920	K205*	probably null	Het
Ankrd27	T	A	7: 35,632,985	S846T	probably benign	Het
Ano3	A	G	2: 110,885,007	S29P	probably benign	Het
Arfgef1	C	T	1: 10,199,878	A349T	probably benign	Het
Arhgef4	A	G	1: 34,811,140	Q1798R	probably damaging	Het
Astn1	G	A	1: 158,509,971	V416I	probably damaging	Het
Atxn2l	G	A	7: 126,493,168	T70I	probably damaging	Het
Auh	G	A	13: 52,835,496	P308L	probably benign	Het
Bspry	T	A	4: 62,494,797	C256S	probably damaging	Het
C3	C	A	17: 57,220,135	W771C	probably damaging	Het
Camkv	A	G	9: 107,947,088	D233G	possibly damaging	Het
Catsperd	T	A	17: 56,635,548	V109E	probably damaging	Het
Cd101	A	G	3: 101,018,917	L162P	probably damaging	Het
Cdr2l	A	G	11: 115,392,777	T154A	probably damaging	Het
Clca3a2	G	C	3: 144,810,696	Q380E	probably benign	Het
Col6a3	T	C	1: 90,822,359	N251S	possibly damaging	Het
Cttnbp2nl	A	G	3: 105,011,278	V82A	possibly damaging	Het
Cux1	G	A	5: 136,363,319	Q194*	probably null	Het
Daam2	T	C	17: 49,485,457	E361G	probably benign	Het
Dcaf17	A	T	2: 71,078,172		probably null	Het
Dnaic1	T	C	4: 41,570,020		probably null	Het
Eml5	T	C	12: 98,798,839	Y1617C	probably damaging	Het
Epb41l4b	T	C	4: 57,040,993	E490G	probably damaging	Het
Epha7	T	C	4: 28,963,969	M988T	possibly damaging	Het
Fancm	T	C	12: 65,105,520	C917R	possibly damaging	Het
Fnip1	C	T	11: 54,480,684	T177I	probably damaging	Het
Gm12169	A	G	11: 46,528,531	D58G	possibly damaging	Het
Gm3604	G	T	13: 62,369,942	H201N	probably benign	Het
Gnpda1	T	C	18: 38,333,190		probably null	Het
Gpatch8	A	G	11: 102,508,142		probably null	Het
H2-M3	T	C	17: 37,271,189	Y179H	possibly damaging	Het
H2-Q10	C	A	17: 35,470,488	S62R	probably damaging	Het
Hipk2	G	A	6: 38,818,984	R117*	probably null	Het
Hrg	A	T	16: 22,954,457	Q113H	probably damaging	Het
Kcnj16	T	C	11: 111,024,953	V147A	possibly damaging	Het
Kif1a	T	C	1: 93,019,031	I1650V	possibly damaging	Het
Kmt2a	C	T	9: 44,820,345		probably benign	Het
Krt90	A	T	15: 101,557,230	Y319N	probably damaging	Het
Lipo4	T	C	19: 33,499,271	N359S	possibly damaging	Het
Lrp1b	G	T	2: 41,728,729	T225K	probably benign	Het
Map1a	C	T	2: 121,307,012	P2532S	probably damaging	Het
Mmrn2	A	G	14: 34,397,643	D193G	probably benign	Het
Mpped2	T	A	2: 106,867,032	I284N	probably damaging	Het
Msh6	A	G	17: 87,985,125	H436R	probably benign	Het
Mterf3	A	T	13: 66,930,062	S48T	probably damaging	Het
Muc5b	T	C	7: 141,846,031	F414L	unknown	Het
Mylk4	A	T	13: 32,724,853	D90E	probably benign	Het
Nploc4	A	G	11: 120,404,229	Y420H	probably damaging	Het
Npr2	T	A	4: 43,640,578	Y344N	probably damaging	Het
Nsun5	A	G	5: 135,375,598	T397A	probably benign	Het
Ntsr2	A	T	12: 16,654,110	Q204L	probably damaging	Het
Nwd2	T	A	5: 63,806,180	Y1036N	probably damaging	Het
Oacyl	T	C	18: 65,710,547	V105A	possibly damaging	Het
Olfr791	T	A	10: 129,527,049	V274D	probably damaging	Het
Parp3	T	A	9: 106,475,117	Q70L	possibly damaging	Het
Parp4	T	C	14: 56,624,017	S936P	probably damaging	Het
Pdzd3	T	C	9: 44,250,303	D93G	possibly damaging	Het
Phkb	A	G	8: 85,922,161	E202G	probably benign	Het
Pink1	T	C	4: 138,314,020	N530S	probably benign	Het
Pou3f2	T	C	4: 22,487,119	D338G	probably damaging	Het
Prss8	G	T	7: 127,929,858	L9I	probably benign	Het
Ptpn22	G	A	3: 103,876,738		probably null	Het
Rad54b	A	C	4: 11,601,693	N416T	probably damaging	Het
Rasef	A	G	4: 73,744,114	S200P	possibly damaging	Het
Rb1	T	A	14: 73,212,990	K645*	probably null	Het
Robo2	C	T	16: 73,899,154	G1367D	probably benign	Het
Rp1	A	G	1: 4,352,671	V52A	probably damaging	Het
Samd13	T	C	3: 146,662,712	T23A	probably benign	Het
Scn7a	T	C	2: 66,699,973	H676R	probably damaging	Het
Serpinb6b	A	G	13: 32,978,240	I222V	probably benign	Het
Slc2a8	T	C	2: 32,980,079	Y150C	probably damaging	Het
Slc7a6os	C	A	8: 106,210,564	R88L	probably damaging	Het
Slc8a2	A	G	7: 16,152,920	I657V	probably benign	Het
Slit2	C	A	5: 48,191,016		probably benign	Het
Spire2	A	G	8: 123,363,071	D447G	probably benign	Het
Sptlc3	A	G	2: 139,566,675	N237D	possibly damaging	Het
Stk3	G	A	15: 35,073,217	T119I	probably damaging	Het
Suv39h2	G	A	2: 3,464,316	T334I	probably damaging	Het
Syt5	G	T	7: 4,540,279	T327N	probably damaging	Het
Tcof1	T	C	18: 60,816,084	D1253G	possibly damaging	Het
Tnks	A	T	8: 34,875,232	V388D	probably damaging	Het
Ugt2b1	T	C	5: 86,926,000	T167A	probably benign	Het
Usp40	G	A	1: 87,995,842	R236C	possibly damaging	Het
Utrn	T	C	10: 12,455,480	D2904G	probably benign	Het
Vmn1r226	T	C	17: 20,687,580	S25P	probably damaging	Het
Vmn2r23	T	C	6: 123,713,010	S282P	possibly damaging	Het
Vps45	T	C	3: 96,046,440	E200G	probably benign	Het
Wnt7b	T	A	15: 85,559,080	I41F	probably damaging	Het
Zmym6	T	A	4: 127,103,414	N275K	probably damaging	Het

Other mutations in Apaf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00590:Apaf1	APN	10	91023788	missense	probably damaging	0.99
IGL00819:Apaf1	APN	10	90997340	splice site	probably null
IGL01481:Apaf1	APN	10	91031588	missense	possibly damaging	0.84
IGL01713:Apaf1	APN	10	91061832	splice site	probably benign
IGL01715:Apaf1	APN	10	91058354	missense	probably benign	0.20
IGL02152:Apaf1	APN	10	91061819	missense	probably benign	0.24
IGL02331:Apaf1	APN	10	91059619	missense	probably damaging	1.00
IGL03071:Apaf1	APN	10	90997255	missense	possibly damaging	0.88
IGL03101:Apaf1	APN	10	91031559	missense	possibly damaging	0.89
IGL03244:Apaf1	APN	10	91049349	splice site	probably benign
Bedlam	UTSW	10	91060271	missense	probably damaging	0.99
Mayhem	UTSW	10	90999719	missense	probably damaging	0.99
Wipeout	UTSW	10	91056000	missense	probably damaging	1.00
R0520:Apaf1	UTSW	10	91079989	missense	probably damaging	0.99
R0600:Apaf1	UTSW	10	91060052	missense	probably damaging	1.00
R0607:Apaf1	UTSW	10	91009203	missense	probably damaging	1.00
R0688:Apaf1	UTSW	10	91061705	missense	possibly damaging	0.94
R0734:Apaf1	UTSW	10	91037021	missense	probably benign	0.02
R1256:Apaf1	UTSW	10	91058406	missense	probably benign
R1459:Apaf1	UTSW	10	91062160	missense	probably benign	0.00
R1485:Apaf1	UTSW	10	91060243	missense	probably benign	0.02
R1511:Apaf1	UTSW	10	91060185	missense	possibly damaging	0.81
R1531:Apaf1	UTSW	10	91054521	missense	probably damaging	1.00
R1705:Apaf1	UTSW	10	91067271	splice site	probably benign
R1925:Apaf1	UTSW	10	90999719	missense	probably damaging	0.99
R2001:Apaf1	UTSW	10	91061814	missense	possibly damaging	0.94
R2002:Apaf1	UTSW	10	91061814	missense	possibly damaging	0.94
R2006:Apaf1	UTSW	10	91061772	missense	probably damaging	1.00
R2043:Apaf1	UTSW	10	91037028	missense	probably damaging	1.00
R2073:Apaf1	UTSW	10	91031694	nonsense	probably null
R2101:Apaf1	UTSW	10	91060080	missense	probably benign	0.26
R2130:Apaf1	UTSW	10	91060165	nonsense	probably null
R2153:Apaf1	UTSW	10	91048090	missense	probably damaging	1.00
R2377:Apaf1	UTSW	10	91079893	missense	possibly damaging	0.95
R2421:Apaf1	UTSW	10	91020723	missense	probably damaging	1.00
R3835:Apaf1	UTSW	10	91059587	missense	probably benign	0.07
R4750:Apaf1	UTSW	10	91060188	missense	probably damaging	1.00
R5100:Apaf1	UTSW	10	90997287	missense	probably benign
R5135:Apaf1	UTSW	10	91060094	missense	probably damaging	1.00
R5497:Apaf1	UTSW	10	90999656	missense	probably damaging	1.00
R5511:Apaf1	UTSW	10	91054392	missense	probably damaging	1.00
R5659:Apaf1	UTSW	10	91062153	nonsense	probably null
R5730:Apaf1	UTSW	10	91020771	missense	possibly damaging	0.62
R6176:Apaf1	UTSW	10	91059571	critical splice donor site	probably null
R6242:Apaf1	UTSW	10	91062163	missense	probably damaging	1.00
R6292:Apaf1	UTSW	10	90991563	missense	possibly damaging	0.86
R6376:Apaf1	UTSW	10	91023811	missense	probably damaging	1.00
R6534:Apaf1	UTSW	10	91056000	missense	probably damaging	1.00
R6975:Apaf1	UTSW	10	91020734	missense	probably damaging	0.97
R7218:Apaf1	UTSW	10	91037002	missense	probably damaging	1.00
R7369:Apaf1	UTSW	10	91001036	missense	probably damaging	0.97
R7409:Apaf1	UTSW	10	91067246	missense	probably damaging	1.00
R7413:Apaf1	UTSW	10	90995680	missense	probably benign	0.28
R7418:Apaf1	UTSW	10	91023835	missense	probably benign	0.09
R7423:Apaf1	UTSW	10	91059606	missense	probably damaging	1.00
R7488:Apaf1	UTSW	10	91054380	missense	probably benign	0.35
R7765:Apaf1	UTSW	10	91023782	missense	probably benign	0.34
R7913:Apaf1	UTSW	10	91060271	missense	probably damaging	0.99
R7914:Apaf1	UTSW	10	91060233	missense	probably damaging	1.00
R7922:Apaf1	UTSW	10	90999753	missense	probably benign
R8131:Apaf1	UTSW	10	91077558	missense	possibly damaging	0.93
R8158:Apaf1	UTSW	10	91059658	missense	probably benign	0.05
R8673:Apaf1	UTSW	10	90995668	missense	probably damaging	1.00
R8682:Apaf1	UTSW	10	90995670	missense	probably damaging	1.00
R8962:Apaf1	UTSW	10	91067204	missense	probably damaging	1.00
R9069:Apaf1	UTSW	10	91023718	critical splice donor site	probably null
R9200:Apaf1	UTSW	10	91009240	missense	probably benign	0.24

Predicted Primers

PCR Primer
(F):5'- AATGCTTTGAGTCCATCCTAGTC -3'
(R):5'- ACTCGAAAAGTAGTCACTGTCAAG -3'

Sequencing Primer
(F):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
(R):5'- GTAGTCACTGTCAAGTTTTGTTCAC -3'

Posted On

2014-07-14