Incidental Mutation 'R1919:Rb1'
ID 212883
Institutional Source Beutler Lab
Gene Symbol Rb1
Ensembl Gene ENSMUSG00000022105
Gene Name RB transcriptional corepressor 1
Synonyms Rb-1, Rb, pRb
MMRRC Submission 039937-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1919 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 73183673-73325822 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 73212990 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 645 (K645*)
Ref Sequence ENSEMBL: ENSMUSP00000022701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022701]
AlphaFold P13405
Predicted Effect probably null
Transcript: ENSMUST00000022701
AA Change: K645*
SMART Domains Protein: ENSMUSP00000022701
Gene: ENSMUSG00000022105
AA Change: K645*

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 37 53 N/A INTRINSIC
DUF3452 97 223 4.59e-25 SMART
RB_A 367 567 5.53e-92 SMART
CYCLIN 653 740 1.62e-5 SMART
Rb_C 761 920 1.28e-96 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163932
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a negative regulator of the cell cycle and was the first tumor suppressor gene found. The encoded protein also stabilizes constitutive heterochromatin to maintain the overall chromatin structure. The active, hypophosphorylated form of the protein binds transcription factor E2F1. Defects in this gene are a cause of childhood cancer retinoblastoma (RB), bladder cancer, and osteogenic sarcoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit abnormalities of the neuronal and hematopoietic systems and die in utero. Heterozygotes may develop pituitary tumors associated with loss of the normal allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,270 (GRCm38) E740G probably damaging Het
4930474N05Rik G T 14: 36,095,457 (GRCm38) V105F possibly damaging Het
4932438A13Rik A G 3: 37,006,983 (GRCm38) probably null Het
Actr10 A G 12: 70,942,330 (GRCm38) I74M probably benign Het
Aen T C 7: 78,905,912 (GRCm38) Y108H probably damaging Het
Afm A T 5: 90,524,920 (GRCm38) K205* probably null Het
Ankrd27 T A 7: 35,632,985 (GRCm38) S846T probably benign Het
Ano3 A G 2: 110,885,007 (GRCm38) S29P probably benign Het
Apaf1 C T 10: 91,077,614 (GRCm38) W138* probably null Het
Arfgef1 C T 1: 10,199,878 (GRCm38) A349T probably benign Het
Arhgef4 A G 1: 34,811,140 (GRCm38) Q1798R probably damaging Het
Astn1 G A 1: 158,509,971 (GRCm38) V416I probably damaging Het
Atxn2l G A 7: 126,493,168 (GRCm38) T70I probably damaging Het
Auh G A 13: 52,835,496 (GRCm38) P308L probably benign Het
Bspry T A 4: 62,494,797 (GRCm38) C256S probably damaging Het
C3 C A 17: 57,220,135 (GRCm38) W771C probably damaging Het
Camkv A G 9: 107,947,088 (GRCm38) D233G possibly damaging Het
Catsperd T A 17: 56,635,548 (GRCm38) V109E probably damaging Het
Cd101 A G 3: 101,018,917 (GRCm38) L162P probably damaging Het
Cdr2l A G 11: 115,392,777 (GRCm38) T154A probably damaging Het
Clca3a2 G C 3: 144,810,696 (GRCm38) Q380E probably benign Het
Col6a3 T C 1: 90,822,359 (GRCm38) N251S possibly damaging Het
Cttnbp2nl A G 3: 105,011,278 (GRCm38) V82A possibly damaging Het
Cux1 G A 5: 136,363,319 (GRCm38) Q194* probably null Het
Daam2 T C 17: 49,485,457 (GRCm38) E361G probably benign Het
Dcaf17 A T 2: 71,078,172 (GRCm38) probably null Het
Dnaic1 T C 4: 41,570,020 (GRCm38) probably null Het
Eml5 T C 12: 98,798,839 (GRCm38) Y1617C probably damaging Het
Epb41l4b T C 4: 57,040,993 (GRCm38) E490G probably damaging Het
Epha7 T C 4: 28,963,969 (GRCm38) M988T possibly damaging Het
Fancm T C 12: 65,105,520 (GRCm38) C917R possibly damaging Het
Fnip1 C T 11: 54,480,684 (GRCm38) T177I probably damaging Het
Gm12169 A G 11: 46,528,531 (GRCm38) D58G possibly damaging Het
Gm3604 G T 13: 62,369,942 (GRCm38) H201N probably benign Het
Gnpda1 T C 18: 38,333,190 (GRCm38) probably null Het
Gpatch8 A G 11: 102,508,142 (GRCm38) probably null Het
H2-M3 T C 17: 37,271,189 (GRCm38) Y179H possibly damaging Het
H2-Q10 C A 17: 35,470,488 (GRCm38) S62R probably damaging Het
Hipk2 G A 6: 38,818,984 (GRCm38) R117* probably null Het
Hrg A T 16: 22,954,457 (GRCm38) Q113H probably damaging Het
Kcnj16 T C 11: 111,024,953 (GRCm38) V147A possibly damaging Het
Kif1a T C 1: 93,019,031 (GRCm38) I1650V possibly damaging Het
Kmt2a C T 9: 44,820,345 (GRCm38) probably benign Het
Krt90 A T 15: 101,557,230 (GRCm38) Y319N probably damaging Het
Lipo4 T C 19: 33,499,271 (GRCm38) N359S possibly damaging Het
Lrp1b G T 2: 41,728,729 (GRCm38) T225K probably benign Het
Map1a C T 2: 121,307,012 (GRCm38) P2532S probably damaging Het
Mmrn2 A G 14: 34,397,643 (GRCm38) D193G probably benign Het
Mpped2 T A 2: 106,867,032 (GRCm38) I284N probably damaging Het
Msh6 A G 17: 87,985,125 (GRCm38) H436R probably benign Het
Mterf3 A T 13: 66,930,062 (GRCm38) S48T probably damaging Het
Muc5b T C 7: 141,846,031 (GRCm38) F414L unknown Het
Mylk4 A T 13: 32,724,853 (GRCm38) D90E probably benign Het
Nploc4 A G 11: 120,404,229 (GRCm38) Y420H probably damaging Het
Npr2 T A 4: 43,640,578 (GRCm38) Y344N probably damaging Het
Nsun5 A G 5: 135,375,598 (GRCm38) T397A probably benign Het
Ntsr2 A T 12: 16,654,110 (GRCm38) Q204L probably damaging Het
Nwd2 T A 5: 63,806,180 (GRCm38) Y1036N probably damaging Het
Oacyl T C 18: 65,710,547 (GRCm38) V105A possibly damaging Het
Olfr791 T A 10: 129,527,049 (GRCm38) V274D probably damaging Het
Parp3 T A 9: 106,475,117 (GRCm38) Q70L possibly damaging Het
Parp4 T C 14: 56,624,017 (GRCm38) S936P probably damaging Het
Pdzd3 T C 9: 44,250,303 (GRCm38) D93G possibly damaging Het
Phkb A G 8: 85,922,161 (GRCm38) E202G probably benign Het
Pink1 T C 4: 138,314,020 (GRCm38) N530S probably benign Het
Pou3f2 T C 4: 22,487,119 (GRCm38) D338G probably damaging Het
Prss8 G T 7: 127,929,858 (GRCm38) L9I probably benign Het
Ptpn22 G A 3: 103,876,738 (GRCm38) probably null Het
Rad54b A C 4: 11,601,693 (GRCm38) N416T probably damaging Het
Rasef A G 4: 73,744,114 (GRCm38) S200P possibly damaging Het
Robo2 C T 16: 73,899,154 (GRCm38) G1367D probably benign Het
Rp1 A G 1: 4,352,671 (GRCm38) V52A probably damaging Het
Samd13 T C 3: 146,662,712 (GRCm38) T23A probably benign Het
Scn7a T C 2: 66,699,973 (GRCm38) H676R probably damaging Het
Serpinb6b A G 13: 32,978,240 (GRCm38) I222V probably benign Het
Slc2a8 T C 2: 32,980,079 (GRCm38) Y150C probably damaging Het
Slc7a6os C A 8: 106,210,564 (GRCm38) R88L probably damaging Het
Slc8a2 A G 7: 16,152,920 (GRCm38) I657V probably benign Het
Slit2 C A 5: 48,191,016 (GRCm38) probably benign Het
Spire2 A G 8: 123,363,071 (GRCm38) D447G probably benign Het
Sptlc3 A G 2: 139,566,675 (GRCm38) N237D possibly damaging Het
Stk3 G A 15: 35,073,217 (GRCm38) T119I probably damaging Het
Suv39h2 G A 2: 3,464,316 (GRCm38) T334I probably damaging Het
Syt5 G T 7: 4,540,279 (GRCm38) T327N probably damaging Het
Tcof1 T C 18: 60,816,084 (GRCm38) D1253G possibly damaging Het
Tnks A T 8: 34,875,232 (GRCm38) V388D probably damaging Het
Ugt2b1 T C 5: 86,926,000 (GRCm38) T167A probably benign Het
Usp40 G A 1: 87,995,842 (GRCm38) R236C possibly damaging Het
Utrn T C 10: 12,455,480 (GRCm38) D2904G probably benign Het
Vmn1r226 T C 17: 20,687,580 (GRCm38) S25P probably damaging Het
Vmn2r23 T C 6: 123,713,010 (GRCm38) S282P possibly damaging Het
Vps45 T C 3: 96,046,440 (GRCm38) E200G probably benign Het
Wnt7b T A 15: 85,559,080 (GRCm38) I41F probably damaging Het
Zmym6 T A 4: 127,103,414 (GRCm38) N275K probably damaging Het
Other mutations in Rb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Rb1 APN 14 73,264,598 (GRCm38) missense probably damaging 1.00
IGL00951:Rb1 APN 14 73,322,072 (GRCm38) missense probably damaging 1.00
IGL01152:Rb1 APN 14 73,205,870 (GRCm38) missense probably damaging 1.00
IGL01339:Rb1 APN 14 73,264,371 (GRCm38) critical splice acceptor site probably null
IGL01349:Rb1 APN 14 73,269,118 (GRCm38) missense probably damaging 1.00
IGL01390:Rb1 APN 14 73,294,999 (GRCm38) missense probably benign 0.02
IGL02066:Rb1 APN 14 73,198,534 (GRCm38) missense probably benign 0.06
IGL02207:Rb1 APN 14 73,206,085 (GRCm38) missense probably damaging 1.00
IGL02860:Rb1 APN 14 73,206,012 (GRCm38) missense probably damaging 1.00
IGL03370:Rb1 APN 14 73,282,866 (GRCm38) critical splice donor site probably null
rubidium UTSW 14 73,199,311 (GRCm38) missense probably damaging 1.00
P0028:Rb1 UTSW 14 73,264,628 (GRCm38) missense probably damaging 1.00
R0553:Rb1 UTSW 14 73,211,712 (GRCm38) nonsense probably null
R0563:Rb1 UTSW 14 73,216,767 (GRCm38) missense probably damaging 1.00
R0586:Rb1 UTSW 14 73,287,684 (GRCm38) intron probably benign
R0595:Rb1 UTSW 14 73,273,680 (GRCm38) missense probably damaging 1.00
R0755:Rb1 UTSW 14 73,197,213 (GRCm38) makesense probably null
R1480:Rb1 UTSW 14 73,262,602 (GRCm38) missense probably benign
R1513:Rb1 UTSW 14 73,322,084 (GRCm38) missense probably benign 0.00
R1752:Rb1 UTSW 14 73,287,624 (GRCm38) missense probably damaging 0.99
R2010:Rb1 UTSW 14 73,294,993 (GRCm38) missense probably benign 0.16
R2087:Rb1 UTSW 14 73,280,252 (GRCm38) missense probably benign 0.09
R2152:Rb1 UTSW 14 73,288,725 (GRCm38) missense probably benign
R2167:Rb1 UTSW 14 73,211,651 (GRCm38) missense probably damaging 1.00
R3950:Rb1 UTSW 14 73,262,662 (GRCm38) missense probably damaging 1.00
R4183:Rb1 UTSW 14 73,198,526 (GRCm38) splice site probably null
R4225:Rb1 UTSW 14 73,269,191 (GRCm38) missense possibly damaging 0.58
R4306:Rb1 UTSW 14 73,262,695 (GRCm38) missense probably damaging 1.00
R4464:Rb1 UTSW 14 73,199,198 (GRCm38) splice site probably null
R4609:Rb1 UTSW 14 73,262,514 (GRCm38) splice site probably benign
R4671:Rb1 UTSW 14 73,273,676 (GRCm38) missense probably damaging 1.00
R4916:Rb1 UTSW 14 73,216,691 (GRCm38) missense probably damaging 1.00
R5160:Rb1 UTSW 14 73,264,455 (GRCm38) synonymous silent
R5210:Rb1 UTSW 14 73,199,311 (GRCm38) missense probably damaging 1.00
R5320:Rb1 UTSW 14 73,213,126 (GRCm38) nonsense probably null
R5436:Rb1 UTSW 14 73,213,140 (GRCm38) splice site probably null
R5467:Rb1 UTSW 14 73,211,620 (GRCm38) missense possibly damaging 0.92
R5592:Rb1 UTSW 14 73,211,747 (GRCm38) missense probably damaging 1.00
R6326:Rb1 UTSW 14 73,198,534 (GRCm38) missense probably benign 0.06
R6363:Rb1 UTSW 14 73,287,641 (GRCm38) missense probably benign 0.01
R6395:Rb1 UTSW 14 73,199,196 (GRCm38) missense probably damaging 1.00
R6414:Rb1 UTSW 14 73,282,974 (GRCm38) missense unknown
R6460:Rb1 UTSW 14 73,278,454 (GRCm38) missense probably benign 0.06
R6503:Rb1 UTSW 14 73,205,880 (GRCm38) missense probably benign 0.08
R6519:Rb1 UTSW 14 73,298,063 (GRCm38) missense probably benign 0.00
R6671:Rb1 UTSW 14 73,197,266 (GRCm38) missense probably damaging 1.00
R7026:Rb1 UTSW 14 73,298,099 (GRCm38) missense probably benign 0.00
R7103:Rb1 UTSW 14 73,262,644 (GRCm38) missense probably damaging 1.00
R7263:Rb1 UTSW 14 73,282,923 (GRCm38) nonsense probably null
R7478:Rb1 UTSW 14 73,269,137 (GRCm38) missense probably damaging 1.00
R7519:Rb1 UTSW 14 73,264,608 (GRCm38) missense probably damaging 1.00
R7817:Rb1 UTSW 14 73,198,543 (GRCm38) missense probably damaging 1.00
R8323:Rb1 UTSW 14 73,265,583 (GRCm38) missense probably benign 0.09
R8809:Rb1 UTSW 14 73,265,560 (GRCm38) missense probably damaging 1.00
R8813:Rb1 UTSW 14 73,262,587 (GRCm38) missense probably damaging 0.96
R8849:Rb1 UTSW 14 73,197,269 (GRCm38) missense probably damaging 1.00
R9272:Rb1 UTSW 14 73,280,162 (GRCm38) missense possibly damaging 0.85
R9482:Rb1 UTSW 14 73,206,053 (GRCm38) missense probably damaging 1.00
R9606:Rb1 UTSW 14 73,280,133 (GRCm38) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAGGCTATACTTGAAAAGGGATTG -3'
(R):5'- TGGGTGTGAAACGAACACTTATC -3'

Sequencing Primer
(F):5'- GAACTCGCTTTGTAGACCAGACTG -3'
(R):5'- GGTGTGAAACGAACACTTATCTTCTG -3'
Posted On 2014-07-14