Incidental Mutation 'R1919:Rb1'
ID212883
Institutional Source Beutler Lab
Gene Symbol Rb1
Ensembl Gene ENSMUSG00000022105
Gene NameRB transcriptional corepressor 1
SynonymsRb-1, Rb, pRb
MMRRC Submission 039937-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1919 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location73183673-73325822 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 73212990 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 645 (K645*)
Ref Sequence ENSEMBL: ENSMUSP00000022701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022701]
Predicted Effect probably null
Transcript: ENSMUST00000022701
AA Change: K645*
SMART Domains Protein: ENSMUSP00000022701
Gene: ENSMUSG00000022105
AA Change: K645*

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 37 53 N/A INTRINSIC
DUF3452 97 223 4.59e-25 SMART
RB_A 367 567 5.53e-92 SMART
CYCLIN 653 740 1.62e-5 SMART
Rb_C 761 920 1.28e-96 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163932
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a negative regulator of the cell cycle and was the first tumor suppressor gene found. The encoded protein also stabilizes constitutive heterochromatin to maintain the overall chromatin structure. The active, hypophosphorylated form of the protein binds transcription factor E2F1. Defects in this gene are a cause of childhood cancer retinoblastoma (RB), bladder cancer, and osteogenic sarcoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit abnormalities of the neuronal and hematopoietic systems and die in utero. Heterozygotes may develop pituitary tumors associated with loss of the normal allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,270 E740G probably damaging Het
4930474N05Rik G T 14: 36,095,457 V105F possibly damaging Het
4932438A13Rik A G 3: 37,006,983 probably null Het
Actr10 A G 12: 70,942,330 I74M probably benign Het
Aen T C 7: 78,905,912 Y108H probably damaging Het
Afm A T 5: 90,524,920 K205* probably null Het
Ankrd27 T A 7: 35,632,985 S846T probably benign Het
Ano3 A G 2: 110,885,007 S29P probably benign Het
Apaf1 C T 10: 91,077,614 W138* probably null Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgef4 A G 1: 34,811,140 Q1798R probably damaging Het
Astn1 G A 1: 158,509,971 V416I probably damaging Het
Atxn2l G A 7: 126,493,168 T70I probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bspry T A 4: 62,494,797 C256S probably damaging Het
C3 C A 17: 57,220,135 W771C probably damaging Het
Camkv A G 9: 107,947,088 D233G possibly damaging Het
Catsperd T A 17: 56,635,548 V109E probably damaging Het
Cd101 A G 3: 101,018,917 L162P probably damaging Het
Cdr2l A G 11: 115,392,777 T154A probably damaging Het
Clca3a2 G C 3: 144,810,696 Q380E probably benign Het
Col6a3 T C 1: 90,822,359 N251S possibly damaging Het
Cttnbp2nl A G 3: 105,011,278 V82A possibly damaging Het
Cux1 G A 5: 136,363,319 Q194* probably null Het
Daam2 T C 17: 49,485,457 E361G probably benign Het
Dcaf17 A T 2: 71,078,172 probably null Het
Dnaic1 T C 4: 41,570,020 probably null Het
Eml5 T C 12: 98,798,839 Y1617C probably damaging Het
Epb41l4b T C 4: 57,040,993 E490G probably damaging Het
Epha7 T C 4: 28,963,969 M988T possibly damaging Het
Fancm T C 12: 65,105,520 C917R possibly damaging Het
Fnip1 C T 11: 54,480,684 T177I probably damaging Het
Gm12169 A G 11: 46,528,531 D58G possibly damaging Het
Gm3604 G T 13: 62,369,942 H201N probably benign Het
Gnpda1 T C 18: 38,333,190 probably null Het
Gpatch8 A G 11: 102,508,142 probably null Het
H2-M3 T C 17: 37,271,189 Y179H possibly damaging Het
H2-Q10 C A 17: 35,470,488 S62R probably damaging Het
Hipk2 G A 6: 38,818,984 R117* probably null Het
Hrg A T 16: 22,954,457 Q113H probably damaging Het
Kcnj16 T C 11: 111,024,953 V147A possibly damaging Het
Kif1a T C 1: 93,019,031 I1650V possibly damaging Het
Kmt2a C T 9: 44,820,345 probably benign Het
Krt90 A T 15: 101,557,230 Y319N probably damaging Het
Lipo4 T C 19: 33,499,271 N359S possibly damaging Het
Lrp1b G T 2: 41,728,729 T225K probably benign Het
Map1a C T 2: 121,307,012 P2532S probably damaging Het
Mmrn2 A G 14: 34,397,643 D193G probably benign Het
Mpped2 T A 2: 106,867,032 I284N probably damaging Het
Msh6 A G 17: 87,985,125 H436R probably benign Het
Mterf3 A T 13: 66,930,062 S48T probably damaging Het
Muc5b T C 7: 141,846,031 F414L unknown Het
Mylk4 A T 13: 32,724,853 D90E probably benign Het
Nploc4 A G 11: 120,404,229 Y420H probably damaging Het
Npr2 T A 4: 43,640,578 Y344N probably damaging Het
Nsun5 A G 5: 135,375,598 T397A probably benign Het
Ntsr2 A T 12: 16,654,110 Q204L probably damaging Het
Nwd2 T A 5: 63,806,180 Y1036N probably damaging Het
Oacyl T C 18: 65,710,547 V105A possibly damaging Het
Olfr791 T A 10: 129,527,049 V274D probably damaging Het
Parp3 T A 9: 106,475,117 Q70L possibly damaging Het
Parp4 T C 14: 56,624,017 S936P probably damaging Het
Pdzd3 T C 9: 44,250,303 D93G possibly damaging Het
Phkb A G 8: 85,922,161 E202G probably benign Het
Pink1 T C 4: 138,314,020 N530S probably benign Het
Pou3f2 T C 4: 22,487,119 D338G probably damaging Het
Prss8 G T 7: 127,929,858 L9I probably benign Het
Ptpn22 G A 3: 103,876,738 probably null Het
Rad54b A C 4: 11,601,693 N416T probably damaging Het
Rasef A G 4: 73,744,114 S200P possibly damaging Het
Robo2 C T 16: 73,899,154 G1367D probably benign Het
Rp1 A G 1: 4,352,671 V52A probably damaging Het
Samd13 T C 3: 146,662,712 T23A probably benign Het
Scn7a T C 2: 66,699,973 H676R probably damaging Het
Serpinb6b A G 13: 32,978,240 I222V probably benign Het
Slc2a8 T C 2: 32,980,079 Y150C probably damaging Het
Slc7a6os C A 8: 106,210,564 R88L probably damaging Het
Slc8a2 A G 7: 16,152,920 I657V probably benign Het
Slit2 C A 5: 48,191,016 probably benign Het
Spire2 A G 8: 123,363,071 D447G probably benign Het
Sptlc3 A G 2: 139,566,675 N237D possibly damaging Het
Stk3 G A 15: 35,073,217 T119I probably damaging Het
Suv39h2 G A 2: 3,464,316 T334I probably damaging Het
Syt5 G T 7: 4,540,279 T327N probably damaging Het
Tcof1 T C 18: 60,816,084 D1253G possibly damaging Het
Tnks A T 8: 34,875,232 V388D probably damaging Het
Ugt2b1 T C 5: 86,926,000 T167A probably benign Het
Usp40 G A 1: 87,995,842 R236C possibly damaging Het
Utrn T C 10: 12,455,480 D2904G probably benign Het
Vmn1r226 T C 17: 20,687,580 S25P probably damaging Het
Vmn2r23 T C 6: 123,713,010 S282P possibly damaging Het
Vps45 T C 3: 96,046,440 E200G probably benign Het
Wnt7b T A 15: 85,559,080 I41F probably damaging Het
Zmym6 T A 4: 127,103,414 N275K probably damaging Het
Other mutations in Rb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Rb1 APN 14 73264598 missense probably damaging 1.00
IGL00951:Rb1 APN 14 73322072 missense probably damaging 1.00
IGL01152:Rb1 APN 14 73205870 missense probably damaging 1.00
IGL01339:Rb1 APN 14 73264371 critical splice acceptor site probably null
IGL01349:Rb1 APN 14 73269118 missense probably damaging 1.00
IGL01390:Rb1 APN 14 73294999 missense probably benign 0.02
IGL02066:Rb1 APN 14 73198534 missense probably benign 0.06
IGL02207:Rb1 APN 14 73206085 missense probably damaging 1.00
IGL02860:Rb1 APN 14 73206012 missense probably damaging 1.00
IGL03370:Rb1 APN 14 73282866 critical splice donor site probably null
rubidium UTSW 14 73199311 missense probably damaging 1.00
P0028:Rb1 UTSW 14 73264628 missense probably damaging 1.00
R0553:Rb1 UTSW 14 73211712 nonsense probably null
R0563:Rb1 UTSW 14 73216767 missense probably damaging 1.00
R0586:Rb1 UTSW 14 73287684 intron probably benign
R0595:Rb1 UTSW 14 73273680 missense probably damaging 1.00
R0755:Rb1 UTSW 14 73197213 makesense probably null
R1480:Rb1 UTSW 14 73262602 missense probably benign
R1513:Rb1 UTSW 14 73322084 missense probably benign 0.00
R1752:Rb1 UTSW 14 73287624 missense probably damaging 0.99
R2010:Rb1 UTSW 14 73294993 missense probably benign 0.16
R2087:Rb1 UTSW 14 73280252 missense probably benign 0.09
R2152:Rb1 UTSW 14 73288725 missense probably benign
R2167:Rb1 UTSW 14 73211651 missense probably damaging 1.00
R3950:Rb1 UTSW 14 73262662 missense probably damaging 1.00
R4183:Rb1 UTSW 14 73198526 splice site probably null
R4225:Rb1 UTSW 14 73269191 missense possibly damaging 0.58
R4306:Rb1 UTSW 14 73262695 missense probably damaging 1.00
R4464:Rb1 UTSW 14 73199198 intron probably null
R4609:Rb1 UTSW 14 73262514 splice site probably benign
R4671:Rb1 UTSW 14 73273676 missense probably damaging 1.00
R4916:Rb1 UTSW 14 73216691 missense probably damaging 1.00
R5160:Rb1 UTSW 14 73264455 synonymous silent
R5210:Rb1 UTSW 14 73199311 missense probably damaging 1.00
R5320:Rb1 UTSW 14 73213126 nonsense probably null
R5436:Rb1 UTSW 14 73213140 splice site probably null
R5467:Rb1 UTSW 14 73211620 missense possibly damaging 0.92
R5592:Rb1 UTSW 14 73211747 missense probably damaging 1.00
R6326:Rb1 UTSW 14 73198534 missense probably benign 0.06
R6363:Rb1 UTSW 14 73287641 missense probably benign 0.01
R6395:Rb1 UTSW 14 73199196 missense probably damaging 1.00
R6414:Rb1 UTSW 14 73282974 missense unknown
R6460:Rb1 UTSW 14 73278454 missense probably benign 0.06
R6503:Rb1 UTSW 14 73205880 missense probably benign 0.08
R6519:Rb1 UTSW 14 73298063 missense probably benign 0.00
R6671:Rb1 UTSW 14 73197266 missense probably damaging 1.00
R7026:Rb1 UTSW 14 73298099 missense probably benign 0.00
R7103:Rb1 UTSW 14 73262644 missense probably damaging 1.00
R7263:Rb1 UTSW 14 73282923 nonsense probably null
R7478:Rb1 UTSW 14 73269137 missense probably damaging 1.00
R7519:Rb1 UTSW 14 73264608 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGCTATACTTGAAAAGGGATTG -3'
(R):5'- TGGGTGTGAAACGAACACTTATC -3'

Sequencing Primer
(F):5'- GAACTCGCTTTGTAGACCAGACTG -3'
(R):5'- GGTGTGAAACGAACACTTATCTTCTG -3'
Posted On2014-07-14