Mutagenetix > Incidental Mutations

Incidental Mutation 'R1919:Msh6'

212898

Institutional Source

Beutler Lab

Gene Symbol

Msh6

Ensembl Gene

ENSMUSG00000005370

Gene Name

mutS homolog 6

Synonyms

GTBP, Gtmbp, Msh6

MMRRC Submission

039937-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1919 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

87975050-87990883 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 87985125 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 436 (H436R)

Ref Sequence

ENSEMBL: ENSMUSP00000005503 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005503]

AlphaFold

P54276

Predicted Effect

probably benign
Transcript: ENSMUST00000005503
AA Change: H436R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000005503
Gene: ENSMUSG00000005370
AA Change: H436R

Domain	Start	End	E-Value	Type
low complexity region	23	46	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
PWWP	90	152	9.01e-30	SMART
low complexity region	198	212	N/A	INTRINSIC
low complexity region	216	230	N/A	INTRINSIC
low complexity region	239	264	N/A	INTRINSIC
low complexity region	273	291	N/A	INTRINSIC
low complexity region	373	389	N/A	INTRINSIC
Pfam:MutS_I	406	525	4.7e-35	PFAM
Pfam:MutS_II	536	700	1.4e-10	PFAM
MUTSd	750	1100	4.56e-86	SMART
MUTSac	1125	1319	1.68e-116	SMART

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.7%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death and are predisposed to tumor formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,067,270	E740G	probably damaging	Het
4930474N05Rik	G	T	14: 36,095,457	V105F	possibly damaging	Het
4932438A13Rik	A	G	3: 37,006,983		probably null	Het
Actr10	A	G	12: 70,942,330	I74M	probably benign	Het
Aen	T	C	7: 78,905,912	Y108H	probably damaging	Het
Afm	A	T	5: 90,524,920	K205*	probably null	Het
Ankrd27	T	A	7: 35,632,985	S846T	probably benign	Het
Ano3	A	G	2: 110,885,007	S29P	probably benign	Het
Apaf1	C	T	10: 91,077,614	W138*	probably null	Het
Arfgef1	C	T	1: 10,199,878	A349T	probably benign	Het
Arhgef4	A	G	1: 34,811,140	Q1798R	probably damaging	Het
Astn1	G	A	1: 158,509,971	V416I	probably damaging	Het
Atxn2l	G	A	7: 126,493,168	T70I	probably damaging	Het
Auh	G	A	13: 52,835,496	P308L	probably benign	Het
Bspry	T	A	4: 62,494,797	C256S	probably damaging	Het
C3	C	A	17: 57,220,135	W771C	probably damaging	Het
Camkv	A	G	9: 107,947,088	D233G	possibly damaging	Het
Catsperd	T	A	17: 56,635,548	V109E	probably damaging	Het
Cd101	A	G	3: 101,018,917	L162P	probably damaging	Het
Cdr2l	A	G	11: 115,392,777	T154A	probably damaging	Het
Clca3a2	G	C	3: 144,810,696	Q380E	probably benign	Het
Col6a3	T	C	1: 90,822,359	N251S	possibly damaging	Het
Cttnbp2nl	A	G	3: 105,011,278	V82A	possibly damaging	Het
Cux1	G	A	5: 136,363,319	Q194*	probably null	Het
Daam2	T	C	17: 49,485,457	E361G	probably benign	Het
Dcaf17	A	T	2: 71,078,172		probably null	Het
Dnaic1	T	C	4: 41,570,020		probably null	Het
Eml5	T	C	12: 98,798,839	Y1617C	probably damaging	Het
Epb41l4b	T	C	4: 57,040,993	E490G	probably damaging	Het
Epha7	T	C	4: 28,963,969	M988T	possibly damaging	Het
Fancm	T	C	12: 65,105,520	C917R	possibly damaging	Het
Fnip1	C	T	11: 54,480,684	T177I	probably damaging	Het
Gm12169	A	G	11: 46,528,531	D58G	possibly damaging	Het
Gm3604	G	T	13: 62,369,942	H201N	probably benign	Het
Gnpda1	T	C	18: 38,333,190		probably null	Het
Gpatch8	A	G	11: 102,508,142		probably null	Het
H2-M3	T	C	17: 37,271,189	Y179H	possibly damaging	Het
H2-Q10	C	A	17: 35,470,488	S62R	probably damaging	Het
Hipk2	G	A	6: 38,818,984	R117*	probably null	Het
Hrg	A	T	16: 22,954,457	Q113H	probably damaging	Het
Kcnj16	T	C	11: 111,024,953	V147A	possibly damaging	Het
Kif1a	T	C	1: 93,019,031	I1650V	possibly damaging	Het
Kmt2a	C	T	9: 44,820,345		probably benign	Het
Krt90	A	T	15: 101,557,230	Y319N	probably damaging	Het
Lipo4	T	C	19: 33,499,271	N359S	possibly damaging	Het
Lrp1b	G	T	2: 41,728,729	T225K	probably benign	Het
Map1a	C	T	2: 121,307,012	P2532S	probably damaging	Het
Mmrn2	A	G	14: 34,397,643	D193G	probably benign	Het
Mpped2	T	A	2: 106,867,032	I284N	probably damaging	Het
Mterf3	A	T	13: 66,930,062	S48T	probably damaging	Het
Muc5b	T	C	7: 141,846,031	F414L	unknown	Het
Mylk4	A	T	13: 32,724,853	D90E	probably benign	Het
Nploc4	A	G	11: 120,404,229	Y420H	probably damaging	Het
Npr2	T	A	4: 43,640,578	Y344N	probably damaging	Het
Nsun5	A	G	5: 135,375,598	T397A	probably benign	Het
Ntsr2	A	T	12: 16,654,110	Q204L	probably damaging	Het
Nwd2	T	A	5: 63,806,180	Y1036N	probably damaging	Het
Oacyl	T	C	18: 65,710,547	V105A	possibly damaging	Het
Olfr791	T	A	10: 129,527,049	V274D	probably damaging	Het
Parp3	T	A	9: 106,475,117	Q70L	possibly damaging	Het
Parp4	T	C	14: 56,624,017	S936P	probably damaging	Het
Pdzd3	T	C	9: 44,250,303	D93G	possibly damaging	Het
Phkb	A	G	8: 85,922,161	E202G	probably benign	Het
Pink1	T	C	4: 138,314,020	N530S	probably benign	Het
Pou3f2	T	C	4: 22,487,119	D338G	probably damaging	Het
Prss8	G	T	7: 127,929,858	L9I	probably benign	Het
Ptpn22	G	A	3: 103,876,738		probably null	Het
Rad54b	A	C	4: 11,601,693	N416T	probably damaging	Het
Rasef	A	G	4: 73,744,114	S200P	possibly damaging	Het
Rb1	T	A	14: 73,212,990	K645*	probably null	Het
Robo2	C	T	16: 73,899,154	G1367D	probably benign	Het
Rp1	A	G	1: 4,352,671	V52A	probably damaging	Het
Samd13	T	C	3: 146,662,712	T23A	probably benign	Het
Scn7a	T	C	2: 66,699,973	H676R	probably damaging	Het
Serpinb6b	A	G	13: 32,978,240	I222V	probably benign	Het
Slc2a8	T	C	2: 32,980,079	Y150C	probably damaging	Het
Slc7a6os	C	A	8: 106,210,564	R88L	probably damaging	Het
Slc8a2	A	G	7: 16,152,920	I657V	probably benign	Het
Slit2	C	A	5: 48,191,016		probably benign	Het
Spire2	A	G	8: 123,363,071	D447G	probably benign	Het
Sptlc3	A	G	2: 139,566,675	N237D	possibly damaging	Het
Stk3	G	A	15: 35,073,217	T119I	probably damaging	Het
Suv39h2	G	A	2: 3,464,316	T334I	probably damaging	Het
Syt5	G	T	7: 4,540,279	T327N	probably damaging	Het
Tcof1	T	C	18: 60,816,084	D1253G	possibly damaging	Het
Tnks	A	T	8: 34,875,232	V388D	probably damaging	Het
Ugt2b1	T	C	5: 86,926,000	T167A	probably benign	Het
Usp40	G	A	1: 87,995,842	R236C	possibly damaging	Het
Utrn	T	C	10: 12,455,480	D2904G	probably benign	Het
Vmn1r226	T	C	17: 20,687,580	S25P	probably damaging	Het
Vmn2r23	T	C	6: 123,713,010	S282P	possibly damaging	Het
Vps45	T	C	3: 96,046,440	E200G	probably benign	Het
Wnt7b	T	A	15: 85,559,080	I41F	probably damaging	Het
Zmym6	T	A	4: 127,103,414	N275K	probably damaging	Het

Other mutations in Msh6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01691:Msh6	APN	17	87985479	missense	probably benign
IGL01834:Msh6	APN	17	87985712	missense	probably damaging	1.00
IGL01904:Msh6	APN	17	87984732	missense	probably benign
IGL01957:Msh6	APN	17	87985091	missense	possibly damaging	0.73
IGL02117:Msh6	APN	17	87990806	unclassified	probably benign
IGL02234:Msh6	APN	17	87986801	missense	probably damaging	1.00
IGL02512:Msh6	APN	17	87984732	missense	probably benign
IGL02651:Msh6	APN	17	87989515	missense	probably damaging	1.00
IGL03381:Msh6	APN	17	87985109	missense	probably damaging	1.00
medea	UTSW	17	87980223	nonsense	probably null
medusa	UTSW	17	87988463	unclassified	probably benign
PIT4449001:Msh6	UTSW	17	87986188	missense	probably damaging	0.96
R0196:Msh6	UTSW	17	87980360	missense	possibly damaging	0.95
R0324:Msh6	UTSW	17	87986620	nonsense	probably null
R0492:Msh6	UTSW	17	87975251	missense	probably benign
R0711:Msh6	UTSW	17	87986684	missense	probably damaging	1.00
R1065:Msh6	UTSW	17	87988463	unclassified	probably benign
R1454:Msh6	UTSW	17	87984758	missense	probably benign	0.00
R1740:Msh6	UTSW	17	87985722	missense	possibly damaging	0.72
R1770:Msh6	UTSW	17	87980223	nonsense	probably null
R1771:Msh6	UTSW	17	87984522	missense	probably benign	0.17
R1926:Msh6	UTSW	17	87986225	missense	probably benign
R2026:Msh6	UTSW	17	87990343	missense	probably damaging	1.00
R2095:Msh6	UTSW	17	87988233	missense	possibly damaging	0.93
R2097:Msh6	UTSW	17	87985416	missense	probably benign	0.00
R2149:Msh6	UTSW	17	87986088	missense	probably damaging	1.00
R2156:Msh6	UTSW	17	87986140	nonsense	probably null
R2167:Msh6	UTSW	17	87989483	missense	probably damaging	1.00
R2382:Msh6	UTSW	17	87984731	missense	probably benign
R3005:Msh6	UTSW	17	87988285	missense	probably benign	0.34
R3160:Msh6	UTSW	17	87985481	missense	probably damaging	1.00
R3162:Msh6	UTSW	17	87985481	missense	probably damaging	1.00
R3162:Msh6	UTSW	17	87985481	missense	probably damaging	1.00
R3774:Msh6	UTSW	17	87986181	missense	probably damaging	1.00
R3775:Msh6	UTSW	17	87986181	missense	probably damaging	1.00
R4350:Msh6	UTSW	17	87984584	missense	probably damaging	1.00
R4424:Msh6	UTSW	17	87990789	nonsense	probably null
R4499:Msh6	UTSW	17	87980269	missense	probably damaging	1.00
R4667:Msh6	UTSW	17	87984806	missense	possibly damaging	0.89
R4668:Msh6	UTSW	17	87984806	missense	possibly damaging	0.89
R4669:Msh6	UTSW	17	87984806	missense	possibly damaging	0.89
R4849:Msh6	UTSW	17	87983519	missense	possibly damaging	0.94
R5137:Msh6	UTSW	17	87980288	missense	possibly damaging	0.83
R5472:Msh6	UTSW	17	87984561	missense	possibly damaging	0.81
R5594:Msh6	UTSW	17	87986069	missense	probably benign	0.00
R5607:Msh6	UTSW	17	87986901	missense	probably damaging	1.00
R5608:Msh6	UTSW	17	87986901	missense	probably damaging	1.00
R5660:Msh6	UTSW	17	87984719	missense	possibly damaging	0.94
R6243:Msh6	UTSW	17	87983571	missense	possibly damaging	0.69
R6279:Msh6	UTSW	17	87980249	missense	probably damaging	1.00
R6357:Msh6	UTSW	17	87984460	nonsense	probably null
R6399:Msh6	UTSW	17	87986891	missense	probably damaging	1.00
R6453:Msh6	UTSW	17	87985739	missense	probably damaging	1.00
R6646:Msh6	UTSW	17	87986442	missense	possibly damaging	0.80
R7404:Msh6	UTSW	17	87975120
R7837:Msh6	UTSW	17	87984666	missense	probably damaging	1.00
R8004:Msh6	UTSW	17	87986787	missense	probably damaging	1.00
R8296:Msh6	UTSW	17	87986912	missense	probably damaging	1.00
R8326:Msh6	UTSW	17	87986912	missense	probably damaging	1.00
R8377:Msh6	UTSW	17	87985170	missense	probably damaging	1.00
R8715:Msh6	UTSW	17	87985767	missense	probably benign
X0026:Msh6	UTSW	17	87986181	missense	probably damaging	1.00
X0026:Msh6	UTSW	17	87990614	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GACCCACTGTTTGGTATCACG -3'
(R):5'- TGCCATTTTCCGACATCGCG -3'

Sequencing Primer
(F):5'- GGTATCACGAAACTTTAGAATGGC -3'
(R):5'- GACATCGCGCCTCCATC -3'

Posted On

2014-07-14