Incidental Mutation 'R1919:Tcof1'
ID212901
Institutional Source Beutler Lab
Gene Symbol Tcof1
Ensembl Gene ENSMUSG00000024613
Gene Nametreacle ribosome biogenesis factor 1
Synonymstreacle
MMRRC Submission 039937-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1919 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location60813755-60848971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60816084 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1253 (D1253G)
Ref Sequence ENSEMBL: ENSMUSP00000135476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050487] [ENSMUST00000097563] [ENSMUST00000163446] [ENSMUST00000167610] [ENSMUST00000175934] [ENSMUST00000176630] [ENSMUST00000177172]
Predicted Effect probably benign
Transcript: ENSMUST00000050487
SMART Domains Protein: ENSMUSP00000057836
Gene: ENSMUSG00000024610

DomainStartEndE-ValueType
Pfam:MHC2-interact 1 112 2.8e-40 PFAM
Pfam:MHCassoc_trimer 119 190 6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097563
SMART Domains Protein: ENSMUSP00000095171
Gene: ENSMUSG00000024610

DomainStartEndE-ValueType
Pfam:MHC2-interact 1 112 5.3e-40 PFAM
Pfam:MHCassoc_trimer 119 190 6.7e-36 PFAM
TY 212 258 8.6e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163446
SMART Domains Protein: ENSMUSP00000130454
Gene: ENSMUSG00000024613

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
Pfam:Treacle 108 322 2.2e-8 PFAM
Pfam:Treacle 321 793 4.6e-204 PFAM
low complexity region 819 834 N/A INTRINSIC
low complexity region 855 874 N/A INTRINSIC
low complexity region 879 893 N/A INTRINSIC
low complexity region 916 927 N/A INTRINSIC
low complexity region 967 977 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167610
SMART Domains Protein: ENSMUSP00000126688
Gene: ENSMUSG00000024610

DomainStartEndE-ValueType
Pfam:MHC2-interact 1 112 5.8e-45 PFAM
Pfam:MHCassoc_trimer 119 187 1.7e-34 PFAM
TY 212 258 8.6e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175586
Predicted Effect possibly damaging
Transcript: ENSMUST00000175934
AA Change: D1289G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135639
Gene: ENSMUSG00000024613
AA Change: D1289G

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
low complexity region 75 109 N/A INTRINSIC
Pfam:Treacle 153 329 1.6e-12 PFAM
Pfam:Treacle 321 792 6.1e-175 PFAM
Pfam:Treacle 782 936 3.2e-16 PFAM
low complexity region 969 982 N/A INTRINSIC
low complexity region 1025 1039 N/A INTRINSIC
low complexity region 1060 1074 N/A INTRINSIC
low complexity region 1149 1172 N/A INTRINSIC
low complexity region 1260 1285 N/A INTRINSIC
coiled coil region 1306 1335 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176630
AA Change: D1253G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135476
Gene: ENSMUSG00000024613
AA Change: D1253G

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
Pfam:Treacle 108 323 2.5e-8 PFAM
Pfam:Treacle 321 793 5.9e-204 PFAM
low complexity region 819 834 N/A INTRINSIC
low complexity region 843 857 N/A INTRINSIC
low complexity region 880 891 N/A INTRINSIC
low complexity region 933 946 N/A INTRINSIC
low complexity region 989 1003 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
low complexity region 1224 1249 N/A INTRINSIC
coiled coil region 1270 1299 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177172
SMART Domains Protein: ENSMUSP00000134755
Gene: ENSMUSG00000024613

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
low complexity region 75 109 N/A INTRINSIC
Pfam:Treacle 150 322 1.3e-10 PFAM
Pfam:Treacle 321 506 1.5e-78 PFAM
Pfam:Treacle 498 745 2e-105 PFAM
low complexity region 771 786 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 885 898 N/A INTRINSIC
low complexity region 941 955 N/A INTRINSIC
low complexity region 976 990 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein with a LIS1 homology domain. The protein is involved in ribosomal DNA gene transcription through its interaction with upstream binding factor (UBF). Mutations in this gene have been associated with Treacher Collins syndrome, a disorder which includes abnormal craniofacial development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Heterozygotes for a targeted null mutation die perinatally with severe craniofacial malformations including agenesis of the nasal passages, abnormal development of the maxilla, exencephaly, and anophthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,270 E740G probably damaging Het
4930474N05Rik G T 14: 36,095,457 V105F possibly damaging Het
4932438A13Rik A G 3: 37,006,983 probably null Het
Actr10 A G 12: 70,942,330 I74M probably benign Het
Aen T C 7: 78,905,912 Y108H probably damaging Het
Afm A T 5: 90,524,920 K205* probably null Het
Ankrd27 T A 7: 35,632,985 S846T probably benign Het
Ano3 A G 2: 110,885,007 S29P probably benign Het
Apaf1 C T 10: 91,077,614 W138* probably null Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgef4 A G 1: 34,811,140 Q1798R probably damaging Het
Astn1 G A 1: 158,509,971 V416I probably damaging Het
Atxn2l G A 7: 126,493,168 T70I probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bspry T A 4: 62,494,797 C256S probably damaging Het
C3 C A 17: 57,220,135 W771C probably damaging Het
Camkv A G 9: 107,947,088 D233G possibly damaging Het
Catsperd T A 17: 56,635,548 V109E probably damaging Het
Cd101 A G 3: 101,018,917 L162P probably damaging Het
Cdr2l A G 11: 115,392,777 T154A probably damaging Het
Clca3a2 G C 3: 144,810,696 Q380E probably benign Het
Col6a3 T C 1: 90,822,359 N251S possibly damaging Het
Cttnbp2nl A G 3: 105,011,278 V82A possibly damaging Het
Cux1 G A 5: 136,363,319 Q194* probably null Het
Daam2 T C 17: 49,485,457 E361G probably benign Het
Dcaf17 A T 2: 71,078,172 probably null Het
Dnaic1 T C 4: 41,570,020 probably null Het
Eml5 T C 12: 98,798,839 Y1617C probably damaging Het
Epb41l4b T C 4: 57,040,993 E490G probably damaging Het
Epha7 T C 4: 28,963,969 M988T possibly damaging Het
Fancm T C 12: 65,105,520 C917R possibly damaging Het
Fnip1 C T 11: 54,480,684 T177I probably damaging Het
Gm12169 A G 11: 46,528,531 D58G possibly damaging Het
Gm3604 G T 13: 62,369,942 H201N probably benign Het
Gnpda1 T C 18: 38,333,190 probably null Het
Gpatch8 A G 11: 102,508,142 probably null Het
H2-M3 T C 17: 37,271,189 Y179H possibly damaging Het
H2-Q10 C A 17: 35,470,488 S62R probably damaging Het
Hipk2 G A 6: 38,818,984 R117* probably null Het
Hrg A T 16: 22,954,457 Q113H probably damaging Het
Kcnj16 T C 11: 111,024,953 V147A possibly damaging Het
Kif1a T C 1: 93,019,031 I1650V possibly damaging Het
Kmt2a C T 9: 44,820,345 probably benign Het
Krt90 A T 15: 101,557,230 Y319N probably damaging Het
Lipo4 T C 19: 33,499,271 N359S possibly damaging Het
Lrp1b G T 2: 41,728,729 T225K probably benign Het
Map1a C T 2: 121,307,012 P2532S probably damaging Het
Mmrn2 A G 14: 34,397,643 D193G probably benign Het
Mpped2 T A 2: 106,867,032 I284N probably damaging Het
Msh6 A G 17: 87,985,125 H436R probably benign Het
Mterf3 A T 13: 66,930,062 S48T probably damaging Het
Muc5b T C 7: 141,846,031 F414L unknown Het
Mylk4 A T 13: 32,724,853 D90E probably benign Het
Nploc4 A G 11: 120,404,229 Y420H probably damaging Het
Npr2 T A 4: 43,640,578 Y344N probably damaging Het
Nsun5 A G 5: 135,375,598 T397A probably benign Het
Ntsr2 A T 12: 16,654,110 Q204L probably damaging Het
Nwd2 T A 5: 63,806,180 Y1036N probably damaging Het
Oacyl T C 18: 65,710,547 V105A possibly damaging Het
Olfr791 T A 10: 129,527,049 V274D probably damaging Het
Parp3 T A 9: 106,475,117 Q70L possibly damaging Het
Parp4 T C 14: 56,624,017 S936P probably damaging Het
Pdzd3 T C 9: 44,250,303 D93G possibly damaging Het
Phkb A G 8: 85,922,161 E202G probably benign Het
Pink1 T C 4: 138,314,020 N530S probably benign Het
Pou3f2 T C 4: 22,487,119 D338G probably damaging Het
Prss8 G T 7: 127,929,858 L9I probably benign Het
Ptpn22 G A 3: 103,876,738 probably null Het
Rad54b A C 4: 11,601,693 N416T probably damaging Het
Rasef A G 4: 73,744,114 S200P possibly damaging Het
Rb1 T A 14: 73,212,990 K645* probably null Het
Robo2 C T 16: 73,899,154 G1367D probably benign Het
Rp1 A G 1: 4,352,671 V52A probably damaging Het
Samd13 T C 3: 146,662,712 T23A probably benign Het
Scn7a T C 2: 66,699,973 H676R probably damaging Het
Serpinb6b A G 13: 32,978,240 I222V probably benign Het
Slc2a8 T C 2: 32,980,079 Y150C probably damaging Het
Slc7a6os C A 8: 106,210,564 R88L probably damaging Het
Slc8a2 A G 7: 16,152,920 I657V probably benign Het
Slit2 C A 5: 48,191,016 probably benign Het
Spire2 A G 8: 123,363,071 D447G probably benign Het
Sptlc3 A G 2: 139,566,675 N237D possibly damaging Het
Stk3 G A 15: 35,073,217 T119I probably damaging Het
Suv39h2 G A 2: 3,464,316 T334I probably damaging Het
Syt5 G T 7: 4,540,279 T327N probably damaging Het
Tnks A T 8: 34,875,232 V388D probably damaging Het
Ugt2b1 T C 5: 86,926,000 T167A probably benign Het
Usp40 G A 1: 87,995,842 R236C possibly damaging Het
Utrn T C 10: 12,455,480 D2904G probably benign Het
Vmn1r226 T C 17: 20,687,580 S25P probably damaging Het
Vmn2r23 T C 6: 123,713,010 S282P possibly damaging Het
Vps45 T C 3: 96,046,440 E200G probably benign Het
Wnt7b T A 15: 85,559,080 I41F probably damaging Het
Zmym6 T A 4: 127,103,414 N275K probably damaging Het
Other mutations in Tcof1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tcof1 APN 18 60814568 unclassified probably benign
IGL01339:Tcof1 APN 18 60818095 utr 3 prime probably benign
IGL02072:Tcof1 APN 18 60831565 missense possibly damaging 0.85
IGL02160:Tcof1 APN 18 60848743 unclassified probably benign
IGL02513:Tcof1 APN 18 60831778 missense possibly damaging 0.51
IGL02823:Tcof1 APN 18 60816048 missense probably benign 0.00
IGL03161:Tcof1 APN 18 60833488 missense possibly damaging 0.86
IGL03291:Tcof1 APN 18 60829061 missense possibly damaging 0.71
FR4304:Tcof1 UTSW 18 60835742 unclassified probably benign
FR4589:Tcof1 UTSW 18 60828650 critical splice donor site probably benign
FR4737:Tcof1 UTSW 18 60828650 critical splice donor site probably benign
PIT4802001:Tcof1 UTSW 18 60831938 missense unknown
R0569:Tcof1 UTSW 18 60829035 missense possibly damaging 0.85
R0602:Tcof1 UTSW 18 60833533 missense probably damaging 1.00
R0744:Tcof1 UTSW 18 60845832 missense probably damaging 1.00
R0782:Tcof1 UTSW 18 60816280 missense probably damaging 0.97
R0833:Tcof1 UTSW 18 60845832 missense probably damaging 1.00
R0836:Tcof1 UTSW 18 60845832 missense probably damaging 1.00
R0885:Tcof1 UTSW 18 60835850 missense possibly damaging 0.84
R1465:Tcof1 UTSW 18 60818954 splice site probably benign
R1528:Tcof1 UTSW 18 60814999 nonsense probably null
R1643:Tcof1 UTSW 18 60816228 missense possibly damaging 0.72
R1920:Tcof1 UTSW 18 60838855 missense possibly damaging 0.87
R1921:Tcof1 UTSW 18 60838855 missense possibly damaging 0.87
R2023:Tcof1 UTSW 18 60833533 missense probably damaging 1.00
R2108:Tcof1 UTSW 18 60835773 missense probably damaging 0.97
R2114:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2115:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2116:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2117:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2156:Tcof1 UTSW 18 60831829 missense possibly damaging 0.92
R2221:Tcof1 UTSW 18 60837901 missense possibly damaging 0.51
R2229:Tcof1 UTSW 18 60832177 intron probably benign
R2913:Tcof1 UTSW 18 60816084 missense possibly damaging 0.85
R2914:Tcof1 UTSW 18 60816084 missense possibly damaging 0.85
R3944:Tcof1 UTSW 18 60822837 missense probably damaging 0.98
R3979:Tcof1 UTSW 18 60831533 missense possibly damaging 0.71
R4049:Tcof1 UTSW 18 60832903 missense possibly damaging 0.84
R4125:Tcof1 UTSW 18 60819601 missense unknown
R5047:Tcof1 UTSW 18 60831914 missense possibly damaging 0.86
R5433:Tcof1 UTSW 18 60818033 utr 3 prime probably benign
R5546:Tcof1 UTSW 18 60831556 missense possibly damaging 0.85
R5832:Tcof1 UTSW 18 60819539 missense unknown
R5965:Tcof1 UTSW 18 60833418 critical splice donor site probably null
R6301:Tcof1 UTSW 18 60828825 missense probably damaging 0.97
R6480:Tcof1 UTSW 18 60814780 intron probably null
R6910:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R6911:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R7105:Tcof1 UTSW 18 60843296 missense probably damaging 1.00
R7225:Tcof1 UTSW 18 60828448 missense unknown
R7356:Tcof1 UTSW 18 60818094 missense unknown
R7467:Tcof1 UTSW 18 60831905 missense unknown
R7536:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R7804:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R7818:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
RF001:Tcof1 UTSW 18 60835739 unclassified probably benign
RF005:Tcof1 UTSW 18 60833554 small insertion probably benign
RF007:Tcof1 UTSW 18 60833568 small insertion probably benign
RF009:Tcof1 UTSW 18 60835743 unclassified probably benign
RF010:Tcof1 UTSW 18 60835744 unclassified probably benign
RF011:Tcof1 UTSW 18 60835739 unclassified probably benign
RF013:Tcof1 UTSW 18 60835743 unclassified probably benign
RF015:Tcof1 UTSW 18 60833584 small insertion probably benign
RF016:Tcof1 UTSW 18 60833575 small insertion probably benign
RF022:Tcof1 UTSW 18 60835735 unclassified probably benign
RF024:Tcof1 UTSW 18 60835738 unclassified probably benign
RF027:Tcof1 UTSW 18 60835736 unclassified probably benign
RF029:Tcof1 UTSW 18 60835735 unclassified probably benign
RF029:Tcof1 UTSW 18 60835745 unclassified probably benign
RF030:Tcof1 UTSW 18 60833568 small insertion probably benign
RF030:Tcof1 UTSW 18 60833574 small insertion probably benign
RF030:Tcof1 UTSW 18 60835723 unclassified probably benign
RF031:Tcof1 UTSW 18 60833565 small insertion probably benign
RF031:Tcof1 UTSW 18 60835745 unclassified probably benign
RF035:Tcof1 UTSW 18 60833553 small insertion probably benign
RF036:Tcof1 UTSW 18 60828408 small insertion probably benign
RF036:Tcof1 UTSW 18 60835736 unclassified probably benign
RF038:Tcof1 UTSW 18 60833566 small insertion probably benign
RF040:Tcof1 UTSW 18 60828408 small insertion probably benign
RF040:Tcof1 UTSW 18 60833583 small insertion probably benign
RF041:Tcof1 UTSW 18 60833572 small insertion probably benign
RF041:Tcof1 UTSW 18 60833576 small insertion probably benign
RF043:Tcof1 UTSW 18 60833572 small insertion probably benign
RF050:Tcof1 UTSW 18 60833579 small insertion probably benign
RF051:Tcof1 UTSW 18 60833579 small insertion probably benign
RF053:Tcof1 UTSW 18 60835747 unclassified probably benign
RF056:Tcof1 UTSW 18 60833575 small insertion probably benign
RF057:Tcof1 UTSW 18 60833564 small insertion probably benign
RF057:Tcof1 UTSW 18 60833565 small insertion probably benign
RF057:Tcof1 UTSW 18 60833566 small insertion probably benign
RF057:Tcof1 UTSW 18 60833571 small insertion probably benign
RF060:Tcof1 UTSW 18 60835744 unclassified probably benign
RF060:Tcof1 UTSW 18 60835747 unclassified probably benign
RF063:Tcof1 UTSW 18 60833573 small insertion probably benign
RF064:Tcof1 UTSW 18 60833571 small insertion probably benign
RF064:Tcof1 UTSW 18 60833574 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AACCACTTCCCAGGCTCTTG -3'
(R):5'- TGGTGAAGGTCCTGACAGAG -3'

Sequencing Primer
(F):5'- CTCTTGTTCTCTGTGGAAAGAATGAG -3'
(R):5'- CTTCTGGAGCAGGAACGG -3'
Posted On2014-07-14