Incidental Mutation 'R0125:Map6'
ID 21292
Institutional Source Beutler Lab
Gene Symbol Map6
Ensembl Gene ENSMUSG00000055407
Gene Name microtubule-associated protein 6
Synonyms Mtap6, 2810411E12Rik, F-STOP, STOP
MMRRC Submission 038410-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.150) question?
Stock # R0125 (G1)
Quality Score 170
Status Validated
Chromosome 7
Chromosomal Location 98916654-98986344 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 98985187 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068973] [ENSMUST00000107100] [ENSMUST00000122101] [ENSMUST00000207883] [ENSMUST00000208605] [ENSMUST00000208924]
AlphaFold Q7TSJ2
Predicted Effect probably null
Transcript: ENSMUST00000068973
SMART Domains Protein: ENSMUSP00000064787
Gene: ENSMUSG00000055407

DomainStartEndE-ValueType
low complexity region 42 57 N/A INTRINSIC
low complexity region 93 117 N/A INTRINSIC
internal_repeat_1 191 306 6.21e-27 PROSPERO
internal_repeat_1 302 398 6.21e-27 PROSPERO
low complexity region 501 525 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107100
SMART Domains Protein: ENSMUSP00000102717
Gene: ENSMUSG00000055407

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
internal_repeat_1 28 103 5.9e-29 PROSPERO
internal_repeat_1 120 195 5.9e-29 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000122101
SMART Domains Protein: ENSMUSP00000113183
Gene: ENSMUSG00000055407

DomainStartEndE-ValueType
Pfam:STOP 1 184 1.2e-18 PFAM
internal_repeat_1 191 306 1.99e-35 PROSPERO
internal_repeat_1 302 398 1.99e-35 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000207883
Predicted Effect probably null
Transcript: ENSMUST00000208605
Predicted Effect probably null
Transcript: ENSMUST00000208924
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.1%
Validation Efficiency 98% (96/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated protein. The encoded protein is a calmodulin-binding and calmodulin-regulated protein that is involved in microtubule stabilization. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are devoid of cold-stable microtubules, and exhibit impaired synaptic plasticity, associated with severe behavioral abnormalities that are specifically ameliorated by long-term administration of neuroleptics. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik T C 14: 70,394,096 (GRCm39) probably benign Het
Adam23 T C 1: 63,573,515 (GRCm39) L261P probably benign Het
Adgra3 G A 5: 50,159,194 (GRCm39) probably benign Het
Agtr1b A G 3: 20,369,704 (GRCm39) F301L probably benign Het
Ahnak2 G A 12: 112,748,776 (GRCm39) T357I probably benign Het
Aldh1a7 T C 19: 20,704,430 (GRCm39) probably benign Het
Apoh A T 11: 108,302,899 (GRCm39) N288I probably damaging Het
Arfgap3 A G 15: 83,227,340 (GRCm39) V24A probably benign Het
Atp6v0a1 A G 11: 100,929,677 (GRCm39) probably null Het
Axl A T 7: 25,486,368 (GRCm39) M112K probably benign Het
Bnc2 A C 4: 84,211,169 (GRCm39) I425S probably damaging Het
Ccn4 T C 15: 66,789,194 (GRCm39) S227P possibly damaging Het
Cdc42bpa C T 1: 179,788,763 (GRCm39) T30M probably damaging Het
Cebpz C A 17: 79,227,317 (GRCm39) R1051M possibly damaging Het
Ces1d A C 8: 93,901,810 (GRCm39) probably benign Het
Chd1l T C 3: 97,494,465 (GRCm39) N405S probably benign Het
Chodl G T 16: 78,738,311 (GRCm39) G93V probably damaging Het
Cpeb2 C T 5: 43,395,743 (GRCm39) probably benign Het
Crebbp A G 16: 3,935,105 (GRCm39) probably benign Het
Crybb3 T C 5: 113,227,675 (GRCm39) T49A possibly damaging Het
Ctps1 A G 4: 120,418,722 (GRCm39) probably benign Het
Cyp26b1 A G 6: 84,551,497 (GRCm39) Y240H probably damaging Het
Cyp2d11 A C 15: 82,273,422 (GRCm39) V483G probably benign Het
Dennd2b T C 7: 109,155,545 (GRCm39) K402E probably benign Het
Dnah14 A T 1: 181,579,628 (GRCm39) N3054Y probably damaging Het
Dspp A C 5: 104,325,905 (GRCm39) D756A unknown Het
Dst T C 1: 34,309,984 (GRCm39) S1553P probably damaging Het
Elp4 A G 2: 105,622,559 (GRCm39) probably null Het
Eml6 G T 11: 29,832,088 (GRCm39) T194K probably benign Het
Evi5 A G 5: 107,943,638 (GRCm39) I569T probably benign Het
Fancm C T 12: 65,168,730 (GRCm39) P1698S possibly damaging Het
Fhdc1 T C 3: 84,352,852 (GRCm39) D791G probably benign Het
Frem1 A G 4: 82,930,188 (GRCm39) Y253H probably damaging Het
Gpn3 A G 5: 122,519,481 (GRCm39) Y196C probably benign Het
Hcls1 A G 16: 36,782,525 (GRCm39) D398G probably benign Het
Hydin T C 8: 111,189,163 (GRCm39) V1189A probably benign Het
Itgb3 G A 11: 104,534,789 (GRCm39) D549N probably damaging Het
Itpr2 A G 6: 146,141,951 (GRCm39) F1697S probably benign Het
Klk1b11 A G 7: 43,648,475 (GRCm39) T161A probably benign Het
Kntc1 G A 5: 123,903,120 (GRCm39) probably benign Het
Map3k19 A T 1: 127,750,837 (GRCm39) F838Y probably benign Het
Mcrs1 A G 15: 99,142,608 (GRCm39) probably benign Het
Mdn1 A T 4: 32,729,956 (GRCm39) Y2766F probably damaging Het
Med23 C T 10: 24,776,686 (GRCm39) H739Y probably damaging Het
Mmp17 T A 5: 129,671,646 (GRCm39) D65E possibly damaging Het
Mmp9 T A 2: 164,793,177 (GRCm39) L442Q probably damaging Het
Myo19 T C 11: 84,779,001 (GRCm39) probably benign Het
Nedd1 A C 10: 92,527,791 (GRCm39) S468A possibly damaging Het
Niban2 T A 2: 32,813,833 (GRCm39) V682D probably benign Het
Nlrp4d A C 7: 10,116,316 (GRCm39) V152G probably damaging Het
Nxf1 T A 19: 8,740,170 (GRCm39) D112E probably benign Het
Oas1h A T 5: 121,000,626 (GRCm39) K79* probably null Het
Omg T A 11: 79,393,679 (GRCm39) I60F possibly damaging Het
Or5p69 A G 7: 107,967,576 (GRCm39) Y293C probably damaging Het
Or8b101 A G 9: 38,020,815 (GRCm39) T278A probably benign Het
Or8b1b T A 9: 38,375,757 (GRCm39) L140* probably null Het
Pck1 G A 2: 172,997,874 (GRCm39) W314* probably null Het
Pla2g15 T C 8: 106,889,756 (GRCm39) Y343H probably benign Het
Plcb3 T C 19: 6,936,276 (GRCm39) E749G probably damaging Het
Plgrkt A G 19: 29,328,442 (GRCm39) probably null Het
Pprc1 A G 19: 46,057,951 (GRCm39) probably benign Het
Prkdc A T 16: 15,516,871 (GRCm39) I1082F probably damaging Het
Rapgef6 T A 11: 54,516,701 (GRCm39) Y172* probably null Het
Ros1 G T 10: 52,001,885 (GRCm39) A1079D probably benign Het
Sap30 T C 8: 57,938,545 (GRCm39) E147G probably null Het
Sell T C 1: 163,899,674 (GRCm39) probably benign Het
Senp1 A T 15: 97,946,112 (GRCm39) D544E probably damaging Het
Shpk G A 11: 73,105,048 (GRCm39) probably benign Het
Slc35b1 A T 11: 95,277,353 (GRCm39) T74S probably benign Het
Slc6a3 T A 13: 73,718,098 (GRCm39) probably benign Het
Slf1 T C 13: 77,191,864 (GRCm39) N990S probably benign Het
Smgc A G 15: 91,738,746 (GRCm39) probably benign Het
Snx19 T A 9: 30,351,515 (GRCm39) V861D probably damaging Het
Sprr2e C T 3: 92,260,285 (GRCm39) P39S unknown Het
Sstr2 T A 11: 113,515,303 (GRCm39) M74K probably damaging Het
Svep1 T C 4: 58,099,937 (GRCm39) probably benign Het
Tas2r143 A G 6: 42,377,889 (GRCm39) I240V probably benign Het
Tbrg1 T C 9: 37,563,937 (GRCm39) I233V probably benign Het
Tecpr1 G T 5: 144,134,717 (GRCm39) D1055E probably damaging Het
Thap2 A T 10: 115,212,277 (GRCm39) probably null Het
Tinagl1 A G 4: 130,060,101 (GRCm39) Y388H probably damaging Het
Ttn T A 2: 76,585,896 (GRCm39) Y21945F probably damaging Het
Ugt2b1 A T 5: 87,073,961 (GRCm39) W133R probably benign Het
Usp24 C T 4: 106,254,496 (GRCm39) P1491L possibly damaging Het
Utp15 A G 13: 98,387,390 (GRCm39) S395P possibly damaging Het
Vav1 T A 17: 57,606,847 (GRCm39) L254Q probably damaging Het
Vmn2r104 T C 17: 20,250,069 (GRCm39) Y734C probably damaging Het
Vps8 T A 16: 21,288,904 (GRCm39) V421E probably benign Het
Xkr7 G T 2: 152,874,346 (GRCm39) A138S probably benign Het
Other mutations in Map6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0035:Map6 UTSW 7 98,966,815 (GRCm39) missense probably damaging 1.00
R0035:Map6 UTSW 7 98,966,815 (GRCm39) missense probably damaging 1.00
R0118:Map6 UTSW 7 98,966,824 (GRCm39) missense possibly damaging 0.53
R0244:Map6 UTSW 7 98,986,043 (GRCm39) missense probably benign 0.00
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0974:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R1455:Map6 UTSW 7 98,917,421 (GRCm39) missense probably damaging 1.00
R1678:Map6 UTSW 7 98,917,305 (GRCm39) missense probably damaging 1.00
R1696:Map6 UTSW 7 98,966,664 (GRCm39) splice site probably null
R1866:Map6 UTSW 7 98,965,083 (GRCm39) missense probably damaging 1.00
R2061:Map6 UTSW 7 98,966,679 (GRCm39) missense probably damaging 1.00
R3236:Map6 UTSW 7 98,986,031 (GRCm39) missense probably damaging 1.00
R3625:Map6 UTSW 7 98,918,402 (GRCm39) missense possibly damaging 0.60
R4044:Map6 UTSW 7 98,917,256 (GRCm39) missense probably damaging 1.00
R4570:Map6 UTSW 7 98,985,763 (GRCm39) missense possibly damaging 0.49
R5056:Map6 UTSW 7 98,985,859 (GRCm39) missense probably benign 0.05
R5065:Map6 UTSW 7 98,985,917 (GRCm39) missense probably benign 0.02
R5656:Map6 UTSW 7 98,985,505 (GRCm39) missense probably damaging 1.00
R6101:Map6 UTSW 7 98,917,314 (GRCm39) missense probably damaging 1.00
R6105:Map6 UTSW 7 98,917,314 (GRCm39) missense probably damaging 1.00
R6302:Map6 UTSW 7 98,985,314 (GRCm39) missense probably damaging 0.99
R6450:Map6 UTSW 7 98,917,245 (GRCm39) missense probably damaging 1.00
R6915:Map6 UTSW 7 98,917,454 (GRCm39) missense probably damaging 1.00
R7205:Map6 UTSW 7 98,918,257 (GRCm39) missense probably benign 0.00
R7223:Map6 UTSW 7 98,917,232 (GRCm39) missense probably damaging 1.00
R7293:Map6 UTSW 7 98,985,740 (GRCm39) missense possibly damaging 0.49
R7481:Map6 UTSW 7 98,918,345 (GRCm39) missense possibly damaging 0.57
R7489:Map6 UTSW 7 98,917,268 (GRCm39) missense probably damaging 1.00
R7691:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R7693:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R7695:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R8341:Map6 UTSW 7 98,917,647 (GRCm39) missense possibly damaging 0.75
R8865:Map6 UTSW 7 98,918,192 (GRCm39) missense probably benign 0.37
R8953:Map6 UTSW 7 98,965,078 (GRCm39) missense probably damaging 1.00
R9108:Map6 UTSW 7 98,986,103 (GRCm39) missense probably damaging 1.00
R9173:Map6 UTSW 7 98,917,935 (GRCm39) missense probably damaging 1.00
R9613:Map6 UTSW 7 98,918,384 (GRCm39) missense possibly damaging 0.90
R9654:Map6 UTSW 7 98,986,166 (GRCm39) missense probably damaging 1.00
Z1176:Map6 UTSW 7 98,966,867 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTGAATGACCACTTCCCTGGGC -3'
(R):5'- AGAGCACAGCACCTTGATCCTTTG -3'

Sequencing Primer
(F):5'- TCTGCATTCCCTAGTGATGC -3'
(R):5'- TTTAAGGACCCTGGGACTACAG -3'
Posted On 2013-04-11