Incidental Mutation 'R1920:Nlrp9c'
ID212944
Institutional Source Beutler Lab
Gene Symbol Nlrp9c
Ensembl Gene ENSMUSG00000040614
Gene NameNLR family, pyrin domain containing 9C
SynonymsNalp9c, Nalp-zeta
MMRRC Submission 039938-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1920 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location26322473-26403700 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26384894 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 420 (D420V)
Ref Sequence ENSEMBL: ENSMUSP00000083106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041845] [ENSMUST00000085944]
Predicted Effect probably damaging
Transcript: ENSMUST00000041845
AA Change: D420V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000036041
Gene: ENSMUSG00000040614
AA Change: D420V

DomainStartEndE-ValueType
PYRIN 5 87 7.64e-22 SMART
Pfam:NACHT 143 310 5.2e-31 PFAM
LRR 637 664 4.36e1 SMART
Blast:LRR 666 691 3e-6 BLAST
LRR 693 720 1.02e0 SMART
LRR 722 749 3e0 SMART
LRR 750 777 6.88e-4 SMART
LRR 779 806 5.06e0 SMART
LRR 807 834 1.22e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000085944
AA Change: D420V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000083106
Gene: ENSMUSG00000040614
AA Change: D420V

DomainStartEndE-ValueType
PYRIN 5 87 7.64e-22 SMART
Pfam:NACHT 143 310 2.8e-31 PFAM
LRR 631 658 7.49e0 SMART
LRR 692 719 4.36e1 SMART
Blast:LRR 721 746 8e-6 BLAST
LRR 748 775 1.02e0 SMART
LRR 777 804 3e0 SMART
LRR 805 832 6.88e-4 SMART
LRR 834 861 2.17e0 SMART
LRR 862 889 2.12e-4 SMART
LRR 919 946 1.22e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160948
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.4%
Validation Efficiency 98% (101/103)
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik A G 1: 184,033,631 V77A probably benign Het
Actl7a G A 4: 56,744,135 V221M probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgef10 C T 8: 14,956,987 probably benign Het
Asgr2 T C 11: 70,098,297 L86P possibly damaging Het
Atp12a A G 14: 56,386,851 R919G probably benign Het
Atrn A G 2: 130,995,051 Y1145C probably damaging Het
B3gnt5 T G 16: 19,769,544 L171R probably benign Het
Bbof1 T A 12: 84,411,085 N41K possibly damaging Het
Bdp1 A T 13: 100,098,589 W166R probably benign Het
Bean1 A T 8: 104,211,110 H107L possibly damaging Het
Brd4 T C 17: 32,198,086 probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cep78 G A 19: 15,974,351 probably benign Het
Cfap70 C T 14: 20,394,952 A1087T probably damaging Het
Cideb A G 14: 55,755,243 V72A probably benign Het
Cpz T C 5: 35,517,668 E79G probably damaging Het
Crybg1 A G 10: 43,997,548 L1188P probably damaging Het
Cuzd1 G A 7: 131,309,696 P518L probably benign Het
Cyp2j5 A T 4: 96,663,254 N77K probably damaging Het
Cyp4f39 T G 17: 32,483,291 F254C probably benign Het
Dkk1 C A 19: 30,547,331 V225L probably damaging Het
Dlg5 T C 14: 24,176,571 Y421C probably damaging Het
Dll3 T C 7: 28,298,923 T206A probably benign Het
Dnhd1 T C 7: 105,713,407 C3766R probably benign Het
Dock9 G T 14: 121,583,380 S1534Y probably damaging Het
Dst T C 1: 34,161,029 V96A probably damaging Het
F2r A G 13: 95,604,190 F279S probably damaging Het
Fam208b A T 13: 3,576,612 Y1113N possibly damaging Het
Farp1 C A 14: 121,255,496 N503K probably benign Het
Fbxw2 G A 2: 34,822,764 T95I probably damaging Het
Fis1 A G 5: 136,965,607 T50A probably benign Het
Frzb T G 2: 80,446,428 E138A probably damaging Het
Fsip2 A T 2: 82,986,820 D4299V probably benign Het
Fyco1 C T 9: 123,830,413 D233N probably damaging Het
Gm14548 G C 7: 3,897,872 P20R probably damaging Het
Gmpr A G 13: 45,514,521 probably benign Het
Hc C T 2: 35,029,395 probably benign Het
Hnrnpa1 T C 15: 103,242,272 M186T possibly damaging Het
Kl A G 5: 150,982,667 K501E probably benign Het
Klhl42 A G 6: 147,107,929 N422S probably damaging Het
Kmt2d C G 15: 98,855,590 K127N probably damaging Het
Kmt2d T A 15: 98,855,591 K127M probably damaging Het
Krt39 T A 11: 99,514,635 T480S probably benign Het
Lims2 T A 18: 31,955,342 C198* probably null Het
Mctp1 A G 13: 76,384,610 N26D possibly damaging Het
Mdm4 A G 1: 133,003,800 S168P probably benign Het
Myo3a A G 2: 22,564,996 Y71C probably benign Het
Ntf3 A T 6: 126,102,522 I7N possibly damaging Het
Olfr1113 G A 2: 87,213,377 G162S probably benign Het
Olfr1224-ps1 A G 2: 89,156,581 V198A probably benign Het
Olfr272 G T 4: 52,910,849 T315K probably benign Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Papln C A 12: 83,789,254 Y1222* probably null Het
Pgm3 T G 9: 86,558,478 I387L possibly damaging Het
Pkd1 C A 17: 24,595,157 P4167Q probably damaging Het
Plcb4 T A 2: 136,013,027 V1174E probably damaging Het
Polr1b A G 2: 129,101,111 N9D probably benign Het
Prkaa2 G A 4: 105,036,753 Q456* probably null Het
Ptch2 G T 4: 117,108,661 V425L probably benign Het
Ptprh A T 7: 4,549,395 S957T probably benign Het
Riok1 A G 13: 38,057,201 D444G probably benign Het
Rrbp1 A T 2: 143,988,291 V652E probably benign Het
Rrp36 C T 17: 46,672,745 R47Q possibly damaging Het
Sec24c T C 14: 20,686,887 S304P probably damaging Het
Serpinb6b A T 13: 32,975,008 D64V possibly damaging Het
Serpinb9b A T 13: 33,039,548 probably null Het
Six6 T A 12: 72,941,764 I237N probably damaging Het
Slc25a36 A T 9: 97,093,082 M127K probably benign Het
Slc2a10 A G 2: 165,514,630 D70G probably damaging Het
Slc2a3 T A 6: 122,736,741 I171F probably damaging Het
Smc4 A G 3: 69,033,068 T1087A probably damaging Het
Spg21 A G 9: 65,484,497 Y242C probably damaging Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Stx2 G A 5: 128,988,839 T251M probably damaging Het
Svs3b A T 2: 164,255,928 S158T probably benign Het
Synpo C T 18: 60,603,589 M428I probably benign Het
Tbc1d31 G A 15: 57,912,364 R17H probably damaging Het
Tbl3 G A 17: 24,704,503 T284I probably benign Het
Tcof1 T C 18: 60,838,855 T127A possibly damaging Het
Tgoln1 T C 6: 72,616,101 E132G probably benign Het
Timeless T C 10: 128,241,714 I221T probably damaging Het
Tmem176b C T 6: 48,838,204 A52T possibly damaging Het
Tmem192 C T 8: 64,965,583 L207F probably damaging Het
Trank1 T C 9: 111,347,928 probably null Het
Ttc7b C T 12: 100,415,130 probably null Het
Tubb5 T C 17: 35,835,298 Y340C probably benign Het
Ubr1 G A 2: 120,930,968 T576I probably benign Het
Vcan T C 13: 89,693,015 E1470G probably damaging Het
Vmn1r200 T A 13: 22,395,493 N146K probably damaging Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Vmn2r61 T C 7: 42,300,286 I710T possibly damaging Het
Wipf1 T A 2: 73,440,155 K61N probably benign Het
Zfp112 T C 7: 24,125,237 V210A probably benign Het
Zfp612 G A 8: 110,088,463 V101M probably benign Het
Zfp637 A G 6: 117,845,720 R270G probably damaging Het
Zfp652 A G 11: 95,764,025 E418G possibly damaging Het
Zfp97 A G 17: 17,145,003 I255V probably benign Het
Other mutations in Nlrp9c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Nlrp9c APN 7 26384588 missense probably benign 0.00
IGL00814:Nlrp9c APN 7 26384750 missense probably benign 0.23
IGL00919:Nlrp9c APN 7 26394056 nonsense probably null
IGL01762:Nlrp9c APN 7 26385425 missense probably damaging 1.00
IGL01928:Nlrp9c APN 7 26375422 splice site probably benign
IGL02008:Nlrp9c APN 7 26385151 missense probably benign 0.16
IGL02389:Nlrp9c APN 7 26394207 missense probably benign
IGL02535:Nlrp9c APN 7 26372097 missense probably damaging 1.00
IGL02685:Nlrp9c APN 7 26385557 missense probably damaging 0.98
IGL02904:Nlrp9c APN 7 26375290 missense probably damaging 1.00
IGL02935:Nlrp9c APN 7 26385276 missense probably benign 0.00
IGL03006:Nlrp9c APN 7 26372082 missense probably damaging 0.98
IGL03140:Nlrp9c APN 7 26380489 missense probably benign 0.30
IGL03201:Nlrp9c APN 7 26385108 missense probably benign 0.00
IGL03243:Nlrp9c APN 7 26365032 missense probably damaging 0.99
IGL03054:Nlrp9c UTSW 7 26382276 splice site probably null
K7894:Nlrp9c UTSW 7 26384898 missense possibly damaging 0.94
R0018:Nlrp9c UTSW 7 26371998 missense possibly damaging 0.89
R0018:Nlrp9c UTSW 7 26371998 missense possibly damaging 0.89
R0238:Nlrp9c UTSW 7 26378012 missense possibly damaging 0.90
R0238:Nlrp9c UTSW 7 26378012 missense possibly damaging 0.90
R0335:Nlrp9c UTSW 7 26394136 missense possibly damaging 0.92
R0391:Nlrp9c UTSW 7 26371476 splice site probably benign
R0433:Nlrp9c UTSW 7 26385819 missense probably benign 0.20
R1035:Nlrp9c UTSW 7 26371277 splice site probably benign
R1118:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1119:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1173:Nlrp9c UTSW 7 26380435 missense probably damaging 1.00
R1519:Nlrp9c UTSW 7 26378101 missense possibly damaging 0.88
R1528:Nlrp9c UTSW 7 26382298 missense probably damaging 0.99
R1616:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1774:Nlrp9c UTSW 7 26394118 missense probably benign 0.05
R1789:Nlrp9c UTSW 7 26380490 missense probably benign 0.00
R1869:Nlrp9c UTSW 7 26384820 nonsense probably null
R1870:Nlrp9c UTSW 7 26384820 nonsense probably null
R1987:Nlrp9c UTSW 7 26378056 missense probably benign 0.31
R2022:Nlrp9c UTSW 7 26384796 missense probably damaging 1.00
R2309:Nlrp9c UTSW 7 26378087 missense probably damaging 1.00
R2327:Nlrp9c UTSW 7 26375322 missense probably damaging 1.00
R3405:Nlrp9c UTSW 7 26385282 missense probably benign 0.01
R3548:Nlrp9c UTSW 7 26371451 missense probably damaging 1.00
R3846:Nlrp9c UTSW 7 26382276 splice site probably null
R4179:Nlrp9c UTSW 7 26384661 missense possibly damaging 0.74
R4460:Nlrp9c UTSW 7 26378098 missense probably damaging 1.00
R4669:Nlrp9c UTSW 7 26375368 missense possibly damaging 0.90
R4708:Nlrp9c UTSW 7 26384840 missense probably benign 0.07
R4810:Nlrp9c UTSW 7 26378177 splice site probably null
R4824:Nlrp9c UTSW 7 26380564 missense possibly damaging 0.49
R4915:Nlrp9c UTSW 7 26384460 missense probably benign 0.34
R4996:Nlrp9c UTSW 7 26385747 missense possibly damaging 0.92
R5468:Nlrp9c UTSW 7 26365000 missense probably benign 0.00
R5525:Nlrp9c UTSW 7 26384501 missense probably damaging 1.00
R5526:Nlrp9c UTSW 7 26382366 missense possibly damaging 0.95
R6020:Nlrp9c UTSW 7 26384725 missense probably benign 0.08
R6175:Nlrp9c UTSW 7 26378001 splice site probably null
R6454:Nlrp9c UTSW 7 26385774 missense possibly damaging 0.91
R6493:Nlrp9c UTSW 7 26382387 missense probably damaging 1.00
R6649:Nlrp9c UTSW 7 26371322 missense probably damaging 1.00
R6653:Nlrp9c UTSW 7 26371322 missense probably damaging 1.00
R6739:Nlrp9c UTSW 7 26385425 missense probably damaging 0.99
R6883:Nlrp9c UTSW 7 26378131 missense probably benign 0.18
R7097:Nlrp9c UTSW 7 26385621 missense probably damaging 1.00
R7122:Nlrp9c UTSW 7 26385621 missense probably damaging 1.00
R7174:Nlrp9c UTSW 7 26385297 missense probably benign 0.03
R7365:Nlrp9c UTSW 7 26371397 missense possibly damaging 0.93
R7378:Nlrp9c UTSW 7 26365015 missense probably benign 0.14
R7427:Nlrp9c UTSW 7 26371435 missense probably benign 0.00
R7450:Nlrp9c UTSW 7 26364939 missense probably benign 0.45
X0065:Nlrp9c UTSW 7 26380430 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAATGTCTGTGCATGGGTCC -3'
(R):5'- TCCAGTGAATCAACATCAGCTATCC -3'

Sequencing Primer
(F):5'- CTGTGCATGGGTCCATTGGTTC -3'
(R):5'- CCACACGATATTTATCATGAGTGC -3'
Posted On2014-07-14