Incidental Mutation 'R1920:Cyp4f39'
ID213000
Institutional Source Beutler Lab
Gene Symbol Cyp4f39
Ensembl Gene ENSMUSG00000061126
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 39
Synonyms4732474A20Rik
MMRRC Submission 039938-MU
Accession Numbers

Genbank: NM_177307; MGI: 2445210

Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock #R1920 (G1)
Quality Score216
Status Validated
Chromosome17
Chromosomal Location32468462-32492479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 32483291 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 254 (F254C)
Ref Sequence ENSEMBL: ENSMUSP00000003413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003413]
Predicted Effect probably benign
Transcript: ENSMUST00000003413
AA Change: F254C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000003413
Gene: ENSMUSG00000061126
AA Change: F254C

DomainStartEndE-ValueType
transmembrane domain 18 40 N/A INTRINSIC
Pfam:p450 60 525 5.8e-124 PFAM
Meta Mutation Damage Score 0.3981 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.4%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This gene is part of a cluster of cytochrome P450 genes on chromosome 19 and encodes an enzyme thought to play a role in the 12(R)-lipoxygenase pathway. Mutations in this gene are the cause of ichthyosis lamellar type 3. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik A G 1: 184,033,631 V77A probably benign Het
Actl7a G A 4: 56,744,135 V221M probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgef10 C T 8: 14,956,987 probably benign Het
Asgr2 T C 11: 70,098,297 L86P possibly damaging Het
Atp12a A G 14: 56,386,851 R919G probably benign Het
Atrn A G 2: 130,995,051 Y1145C probably damaging Het
B3gnt5 T G 16: 19,769,544 L171R probably benign Het
Bbof1 T A 12: 84,411,085 N41K possibly damaging Het
Bdp1 A T 13: 100,098,589 W166R probably benign Het
Bean1 A T 8: 104,211,110 H107L possibly damaging Het
Brd4 T C 17: 32,198,086 probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cep78 G A 19: 15,974,351 probably benign Het
Cfap70 C T 14: 20,394,952 A1087T probably damaging Het
Cideb A G 14: 55,755,243 V72A probably benign Het
Cpz T C 5: 35,517,668 E79G probably damaging Het
Crybg1 A G 10: 43,997,548 L1188P probably damaging Het
Cuzd1 G A 7: 131,309,696 P518L probably benign Het
Cyp2j5 A T 4: 96,663,254 N77K probably damaging Het
Dkk1 C A 19: 30,547,331 V225L probably damaging Het
Dlg5 T C 14: 24,176,571 Y421C probably damaging Het
Dll3 T C 7: 28,298,923 T206A probably benign Het
Dnhd1 T C 7: 105,713,407 C3766R probably benign Het
Dock9 G T 14: 121,583,380 S1534Y probably damaging Het
Dst T C 1: 34,161,029 V96A probably damaging Het
F2r A G 13: 95,604,190 F279S probably damaging Het
Fam208b A T 13: 3,576,612 Y1113N possibly damaging Het
Farp1 C A 14: 121,255,496 N503K probably benign Het
Fbxw2 G A 2: 34,822,764 T95I probably damaging Het
Fis1 A G 5: 136,965,607 T50A probably benign Het
Frzb T G 2: 80,446,428 E138A probably damaging Het
Fsip2 A T 2: 82,986,820 D4299V probably benign Het
Fyco1 C T 9: 123,830,413 D233N probably damaging Het
Gm14548 G C 7: 3,897,872 P20R probably damaging Het
Gmpr A G 13: 45,514,521 probably benign Het
Hc C T 2: 35,029,395 probably benign Het
Hnrnpa1 T C 15: 103,242,272 M186T possibly damaging Het
Kl A G 5: 150,982,667 K501E probably benign Het
Klhl42 A G 6: 147,107,929 N422S probably damaging Het
Kmt2d C G 15: 98,855,590 K127N probably damaging Het
Kmt2d T A 15: 98,855,591 K127M probably damaging Het
Krt39 T A 11: 99,514,635 T480S probably benign Het
Lims2 T A 18: 31,955,342 C198* probably null Het
Mctp1 A G 13: 76,384,610 N26D possibly damaging Het
Mdm4 A G 1: 133,003,800 S168P probably benign Het
Myo3a A G 2: 22,564,996 Y71C probably benign Het
Nlrp9c T A 7: 26,384,894 D420V probably damaging Het
Ntf3 A T 6: 126,102,522 I7N possibly damaging Het
Olfr1113 G A 2: 87,213,377 G162S probably benign Het
Olfr1224-ps1 A G 2: 89,156,581 V198A probably benign Het
Olfr272 G T 4: 52,910,849 T315K probably benign Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Papln C A 12: 83,789,254 Y1222* probably null Het
Pgm3 T G 9: 86,558,478 I387L possibly damaging Het
Pkd1 C A 17: 24,595,157 P4167Q probably damaging Het
Plcb4 T A 2: 136,013,027 V1174E probably damaging Het
Polr1b A G 2: 129,101,111 N9D probably benign Het
Prkaa2 G A 4: 105,036,753 Q456* probably null Het
Ptch2 G T 4: 117,108,661 V425L probably benign Het
Ptprh A T 7: 4,549,395 S957T probably benign Het
Riok1 A G 13: 38,057,201 D444G probably benign Het
Rrbp1 A T 2: 143,988,291 V652E probably benign Het
Rrp36 C T 17: 46,672,745 R47Q possibly damaging Het
Sec24c T C 14: 20,686,887 S304P probably damaging Het
Serpinb6b A T 13: 32,975,008 D64V possibly damaging Het
Serpinb9b A T 13: 33,039,548 probably null Het
Six6 T A 12: 72,941,764 I237N probably damaging Het
Slc25a36 A T 9: 97,093,082 M127K probably benign Het
Slc2a10 A G 2: 165,514,630 D70G probably damaging Het
Slc2a3 T A 6: 122,736,741 I171F probably damaging Het
Smc4 A G 3: 69,033,068 T1087A probably damaging Het
Spg21 A G 9: 65,484,497 Y242C probably damaging Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Stx2 G A 5: 128,988,839 T251M probably damaging Het
Svs3b A T 2: 164,255,928 S158T probably benign Het
Synpo C T 18: 60,603,589 M428I probably benign Het
Tbc1d31 G A 15: 57,912,364 R17H probably damaging Het
Tbl3 G A 17: 24,704,503 T284I probably benign Het
Tcof1 T C 18: 60,838,855 T127A possibly damaging Het
Tgoln1 T C 6: 72,616,101 E132G probably benign Het
Timeless T C 10: 128,241,714 I221T probably damaging Het
Tmem176b C T 6: 48,838,204 A52T possibly damaging Het
Tmem192 C T 8: 64,965,583 L207F probably damaging Het
Trank1 T C 9: 111,347,928 probably null Het
Ttc7b C T 12: 100,415,130 probably null Het
Tubb5 T C 17: 35,835,298 Y340C probably benign Het
Ubr1 G A 2: 120,930,968 T576I probably benign Het
Vcan T C 13: 89,693,015 E1470G probably damaging Het
Vmn1r200 T A 13: 22,395,493 N146K probably damaging Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Vmn2r61 T C 7: 42,300,286 I710T possibly damaging Het
Wipf1 T A 2: 73,440,155 K61N probably benign Het
Zfp112 T C 7: 24,125,237 V210A probably benign Het
Zfp612 G A 8: 110,088,463 V101M probably benign Het
Zfp637 A G 6: 117,845,720 R270G probably damaging Het
Zfp652 A G 11: 95,764,025 E418G possibly damaging Het
Zfp97 A G 17: 17,145,003 I255V probably benign Het
Other mutations in Cyp4f39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00789:Cyp4f39 APN 17 32470912 missense probably damaging 1.00
IGL00822:Cyp4f39 APN 17 32470832 missense probably benign 0.03
IGL00857:Cyp4f39 APN 17 32489657 missense probably benign 0.08
IGL01380:Cyp4f39 APN 17 32481858 missense probably damaging 1.00
IGL01532:Cyp4f39 APN 17 32470954 splice site probably benign
IGL01756:Cyp4f39 APN 17 32483441 nonsense probably null
IGL02090:Cyp4f39 APN 17 32470958 splice site probably benign
IGL02477:Cyp4f39 APN 17 32489645 missense probably benign 0.40
IGL02824:Cyp4f39 APN 17 32468685 critical splice donor site probably null
N/A:Cyp4f39 UTSW 17 32468681 missense probably benign 0.03
R0145:Cyp4f39 UTSW 17 32486960 missense possibly damaging 0.92
R0288:Cyp4f39 UTSW 17 32492436 missense probably benign 0.01
R1676:Cyp4f39 UTSW 17 32482202 missense probably benign 0.41
R1677:Cyp4f39 UTSW 17 32492330 missense probably benign 0.30
R1874:Cyp4f39 UTSW 17 32483324 missense probably damaging 1.00
R2049:Cyp4f39 UTSW 17 32482138 missense probably benign 0.41
R2139:Cyp4f39 UTSW 17 32491189 missense probably benign 0.01
R2212:Cyp4f39 UTSW 17 32487063 missense possibly damaging 0.62
R3416:Cyp4f39 UTSW 17 32489742 missense possibly damaging 0.72
R3417:Cyp4f39 UTSW 17 32489742 missense possibly damaging 0.72
R4486:Cyp4f39 UTSW 17 32483454 missense probably damaging 1.00
R5023:Cyp4f39 UTSW 17 32481104 missense probably damaging 1.00
R5523:Cyp4f39 UTSW 17 32470833 missense probably benign 0.10
R5714:Cyp4f39 UTSW 17 32481825 missense probably damaging 1.00
R6010:Cyp4f39 UTSW 17 32482186 missense probably damaging 0.99
R6312:Cyp4f39 UTSW 17 32483294 missense probably benign 0.00
R6477:Cyp4f39 UTSW 17 32481817 missense probably damaging 0.99
R6950:Cyp4f39 UTSW 17 32492306 missense probably damaging 1.00
R7228:Cyp4f39 UTSW 17 32491829 missense probably damaging 1.00
R7311:Cyp4f39 UTSW 17 32489655 missense probably damaging 1.00
R7341:Cyp4f39 UTSW 17 32486954 missense probably damaging 1.00
R7345:Cyp4f39 UTSW 17 32486779 missense probably damaging 1.00
R7405:Cyp4f39 UTSW 17 32481815 missense probably benign 0.01
R7522:Cyp4f39 UTSW 17 32486972 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAAAGCCTCTGTTTGTCGTTATGC -3'
(R):5'- AATTCCCAGCTGGCCTCTAG -3'

Sequencing Primer
(F):5'- TATGCAACGGACTCTGTGC -3'
(R):5'- GTTCTCACCTTGGCCAGCAAC -3'
Posted On2014-07-14