Incidental Mutation 'R1920:Tcof1'
ID213007
Institutional Source Beutler Lab
Gene Symbol Tcof1
Ensembl Gene ENSMUSG00000024613
Gene Nametreacle ribosome biogenesis factor 1
Synonymstreacle
MMRRC Submission 039938-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1920 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location60813755-60848971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60838855 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 127 (T127A)
Ref Sequence ENSEMBL: ENSMUSP00000134755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163446] [ENSMUST00000175934] [ENSMUST00000176630] [ENSMUST00000177172] [ENSMUST00000177343]
Predicted Effect probably benign
Transcript: ENSMUST00000163446
AA Change: T127A

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130454
Gene: ENSMUSG00000024613
AA Change: T127A

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
Pfam:Treacle 108 322 2.2e-8 PFAM
Pfam:Treacle 321 793 4.6e-204 PFAM
low complexity region 819 834 N/A INTRINSIC
low complexity region 855 874 N/A INTRINSIC
low complexity region 879 893 N/A INTRINSIC
low complexity region 916 927 N/A INTRINSIC
low complexity region 967 977 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000175934
AA Change: T127A

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135639
Gene: ENSMUSG00000024613
AA Change: T127A

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
low complexity region 75 109 N/A INTRINSIC
Pfam:Treacle 153 329 1.6e-12 PFAM
Pfam:Treacle 321 792 6.1e-175 PFAM
Pfam:Treacle 782 936 3.2e-16 PFAM
low complexity region 969 982 N/A INTRINSIC
low complexity region 1025 1039 N/A INTRINSIC
low complexity region 1060 1074 N/A INTRINSIC
low complexity region 1149 1172 N/A INTRINSIC
low complexity region 1260 1285 N/A INTRINSIC
coiled coil region 1306 1335 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176630
AA Change: T127A

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135476
Gene: ENSMUSG00000024613
AA Change: T127A

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
Pfam:Treacle 108 323 2.5e-8 PFAM
Pfam:Treacle 321 793 5.9e-204 PFAM
low complexity region 819 834 N/A INTRINSIC
low complexity region 843 857 N/A INTRINSIC
low complexity region 880 891 N/A INTRINSIC
low complexity region 933 946 N/A INTRINSIC
low complexity region 989 1003 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
low complexity region 1224 1249 N/A INTRINSIC
coiled coil region 1270 1299 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000177172
AA Change: T127A

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134755
Gene: ENSMUSG00000024613
AA Change: T127A

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
low complexity region 75 109 N/A INTRINSIC
Pfam:Treacle 150 322 1.3e-10 PFAM
Pfam:Treacle 321 506 1.5e-78 PFAM
Pfam:Treacle 498 745 2e-105 PFAM
low complexity region 771 786 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 885 898 N/A INTRINSIC
low complexity region 941 955 N/A INTRINSIC
low complexity region 976 990 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177343
AA Change: T111A

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000135295
Gene: ENSMUSG00000024613
AA Change: T111A

DomainStartEndE-ValueType
low complexity region 59 93 N/A INTRINSIC
Meta Mutation Damage Score 0.052 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.4%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein with a LIS1 homology domain. The protein is involved in ribosomal DNA gene transcription through its interaction with upstream binding factor (UBF). Mutations in this gene have been associated with Treacher Collins syndrome, a disorder which includes abnormal craniofacial development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Heterozygotes for a targeted null mutation die perinatally with severe craniofacial malformations including agenesis of the nasal passages, abnormal development of the maxilla, exencephaly, and anophthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik A G 1: 184,033,631 V77A probably benign Het
Actl7a G A 4: 56,744,135 V221M probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgef10 C T 8: 14,956,987 probably benign Het
Asgr2 T C 11: 70,098,297 L86P possibly damaging Het
Atp12a A G 14: 56,386,851 R919G probably benign Het
Atrn A G 2: 130,995,051 Y1145C probably damaging Het
B3gnt5 T G 16: 19,769,544 L171R probably benign Het
Bbof1 T A 12: 84,411,085 N41K possibly damaging Het
Bdp1 A T 13: 100,098,589 W166R probably benign Het
Bean1 A T 8: 104,211,110 H107L possibly damaging Het
Brd4 T C 17: 32,198,086 probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cep78 G A 19: 15,974,351 probably benign Het
Cfap70 C T 14: 20,394,952 A1087T probably damaging Het
Cideb A G 14: 55,755,243 V72A probably benign Het
Cpz T C 5: 35,517,668 E79G probably damaging Het
Crybg1 A G 10: 43,997,548 L1188P probably damaging Het
Cuzd1 G A 7: 131,309,696 P518L probably benign Het
Cyp2j5 A T 4: 96,663,254 N77K probably damaging Het
Cyp4f39 T G 17: 32,483,291 F254C probably benign Het
Dkk1 C A 19: 30,547,331 V225L probably damaging Het
Dlg5 T C 14: 24,176,571 Y421C probably damaging Het
Dll3 T C 7: 28,298,923 T206A probably benign Het
Dnhd1 T C 7: 105,713,407 C3766R probably benign Het
Dock9 G T 14: 121,583,380 S1534Y probably damaging Het
Dst T C 1: 34,161,029 V96A probably damaging Het
F2r A G 13: 95,604,190 F279S probably damaging Het
Fam208b A T 13: 3,576,612 Y1113N possibly damaging Het
Farp1 C A 14: 121,255,496 N503K probably benign Het
Fbxw2 G A 2: 34,822,764 T95I probably damaging Het
Fis1 A G 5: 136,965,607 T50A probably benign Het
Frzb T G 2: 80,446,428 E138A probably damaging Het
Fsip2 A T 2: 82,986,820 D4299V probably benign Het
Fyco1 C T 9: 123,830,413 D233N probably damaging Het
Gm14548 G C 7: 3,897,872 P20R probably damaging Het
Gmpr A G 13: 45,514,521 probably benign Het
Hc C T 2: 35,029,395 probably benign Het
Hnrnpa1 T C 15: 103,242,272 M186T possibly damaging Het
Kl A G 5: 150,982,667 K501E probably benign Het
Klhl42 A G 6: 147,107,929 N422S probably damaging Het
Kmt2d C G 15: 98,855,590 K127N probably damaging Het
Kmt2d T A 15: 98,855,591 K127M probably damaging Het
Krt39 T A 11: 99,514,635 T480S probably benign Het
Lims2 T A 18: 31,955,342 C198* probably null Het
Mctp1 A G 13: 76,384,610 N26D possibly damaging Het
Mdm4 A G 1: 133,003,800 S168P probably benign Het
Myo3a A G 2: 22,564,996 Y71C probably benign Het
Nlrp9c T A 7: 26,384,894 D420V probably damaging Het
Ntf3 A T 6: 126,102,522 I7N possibly damaging Het
Olfr1113 G A 2: 87,213,377 G162S probably benign Het
Olfr1224-ps1 A G 2: 89,156,581 V198A probably benign Het
Olfr272 G T 4: 52,910,849 T315K probably benign Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Papln C A 12: 83,789,254 Y1222* probably null Het
Pgm3 T G 9: 86,558,478 I387L possibly damaging Het
Pkd1 C A 17: 24,595,157 P4167Q probably damaging Het
Plcb4 T A 2: 136,013,027 V1174E probably damaging Het
Polr1b A G 2: 129,101,111 N9D probably benign Het
Prkaa2 G A 4: 105,036,753 Q456* probably null Het
Ptch2 G T 4: 117,108,661 V425L probably benign Het
Ptprh A T 7: 4,549,395 S957T probably benign Het
Riok1 A G 13: 38,057,201 D444G probably benign Het
Rrbp1 A T 2: 143,988,291 V652E probably benign Het
Rrp36 C T 17: 46,672,745 R47Q possibly damaging Het
Sec24c T C 14: 20,686,887 S304P probably damaging Het
Serpinb6b A T 13: 32,975,008 D64V possibly damaging Het
Serpinb9b A T 13: 33,039,548 probably null Het
Six6 T A 12: 72,941,764 I237N probably damaging Het
Slc25a36 A T 9: 97,093,082 M127K probably benign Het
Slc2a10 A G 2: 165,514,630 D70G probably damaging Het
Slc2a3 T A 6: 122,736,741 I171F probably damaging Het
Smc4 A G 3: 69,033,068 T1087A probably damaging Het
Spg21 A G 9: 65,484,497 Y242C probably damaging Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Stx2 G A 5: 128,988,839 T251M probably damaging Het
Svs3b A T 2: 164,255,928 S158T probably benign Het
Synpo C T 18: 60,603,589 M428I probably benign Het
Tbc1d31 G A 15: 57,912,364 R17H probably damaging Het
Tbl3 G A 17: 24,704,503 T284I probably benign Het
Tgoln1 T C 6: 72,616,101 E132G probably benign Het
Timeless T C 10: 128,241,714 I221T probably damaging Het
Tmem176b C T 6: 48,838,204 A52T possibly damaging Het
Tmem192 C T 8: 64,965,583 L207F probably damaging Het
Trank1 T C 9: 111,347,928 probably null Het
Ttc7b C T 12: 100,415,130 probably null Het
Tubb5 T C 17: 35,835,298 Y340C probably benign Het
Ubr1 G A 2: 120,930,968 T576I probably benign Het
Vcan T C 13: 89,693,015 E1470G probably damaging Het
Vmn1r200 T A 13: 22,395,493 N146K probably damaging Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Vmn2r61 T C 7: 42,300,286 I710T possibly damaging Het
Wipf1 T A 2: 73,440,155 K61N probably benign Het
Zfp112 T C 7: 24,125,237 V210A probably benign Het
Zfp612 G A 8: 110,088,463 V101M probably benign Het
Zfp637 A G 6: 117,845,720 R270G probably damaging Het
Zfp652 A G 11: 95,764,025 E418G possibly damaging Het
Zfp97 A G 17: 17,145,003 I255V probably benign Het
Other mutations in Tcof1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tcof1 APN 18 60814568 unclassified probably benign
IGL01339:Tcof1 APN 18 60818095 utr 3 prime probably benign
IGL02072:Tcof1 APN 18 60831565 missense possibly damaging 0.85
IGL02160:Tcof1 APN 18 60848743 unclassified probably benign
IGL02513:Tcof1 APN 18 60831778 missense possibly damaging 0.51
IGL02823:Tcof1 APN 18 60816048 missense probably benign 0.00
IGL03161:Tcof1 APN 18 60833488 missense possibly damaging 0.86
IGL03291:Tcof1 APN 18 60829061 missense possibly damaging 0.71
FR4304:Tcof1 UTSW 18 60835742 unclassified probably benign
FR4589:Tcof1 UTSW 18 60828650 critical splice donor site probably benign
FR4737:Tcof1 UTSW 18 60828650 critical splice donor site probably benign
PIT4802001:Tcof1 UTSW 18 60831938 missense unknown
R0569:Tcof1 UTSW 18 60829035 missense possibly damaging 0.85
R0602:Tcof1 UTSW 18 60833533 missense probably damaging 1.00
R0744:Tcof1 UTSW 18 60845832 missense probably damaging 1.00
R0782:Tcof1 UTSW 18 60816280 missense probably damaging 0.97
R0833:Tcof1 UTSW 18 60845832 missense probably damaging 1.00
R0836:Tcof1 UTSW 18 60845832 missense probably damaging 1.00
R0885:Tcof1 UTSW 18 60835850 missense possibly damaging 0.84
R1465:Tcof1 UTSW 18 60818954 splice site probably benign
R1528:Tcof1 UTSW 18 60814999 nonsense probably null
R1643:Tcof1 UTSW 18 60816228 missense possibly damaging 0.72
R1919:Tcof1 UTSW 18 60816084 missense possibly damaging 0.85
R1921:Tcof1 UTSW 18 60838855 missense possibly damaging 0.87
R2023:Tcof1 UTSW 18 60833533 missense probably damaging 1.00
R2108:Tcof1 UTSW 18 60835773 missense probably damaging 0.97
R2114:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2115:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2116:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2117:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2156:Tcof1 UTSW 18 60831829 missense possibly damaging 0.92
R2221:Tcof1 UTSW 18 60837901 missense possibly damaging 0.51
R2229:Tcof1 UTSW 18 60832177 intron probably benign
R2913:Tcof1 UTSW 18 60816084 missense possibly damaging 0.85
R2914:Tcof1 UTSW 18 60816084 missense possibly damaging 0.85
R3944:Tcof1 UTSW 18 60822837 missense probably damaging 0.98
R3979:Tcof1 UTSW 18 60831533 missense possibly damaging 0.71
R4049:Tcof1 UTSW 18 60832903 missense possibly damaging 0.84
R4125:Tcof1 UTSW 18 60819601 missense unknown
R5047:Tcof1 UTSW 18 60831914 missense possibly damaging 0.86
R5433:Tcof1 UTSW 18 60818033 utr 3 prime probably benign
R5546:Tcof1 UTSW 18 60831556 missense possibly damaging 0.85
R5832:Tcof1 UTSW 18 60819539 missense unknown
R5965:Tcof1 UTSW 18 60833418 critical splice donor site probably null
R6301:Tcof1 UTSW 18 60828825 missense probably damaging 0.97
R6480:Tcof1 UTSW 18 60814780 intron probably null
R6910:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R6911:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R7105:Tcof1 UTSW 18 60843296 missense probably damaging 1.00
R7225:Tcof1 UTSW 18 60828448 missense unknown
R7356:Tcof1 UTSW 18 60818094 missense unknown
R7467:Tcof1 UTSW 18 60831905 missense unknown
R7536:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- CACAGTGTTCAGTCCTGACC -3'
(R):5'- GATGACAAACCAGTGGACTGTG -3'

Sequencing Primer
(F):5'- CCAGACTTGGCAGTGGGTC -3'
(R):5'- CTGTGAAAGGCCAGAGCTG -3'
Posted On2014-07-14