Incidental Mutation 'R1921:Aox3'
ID213013
Institutional Source Beutler Lab
Gene Symbol Aox3
Ensembl Gene ENSMUSG00000064294
Gene Namealdehyde oxidase 3
SynonymsAOH1, 1200011D03Rik
MMRRC Submission 039939-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1921 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location58113130-58200698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58180651 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1137 (Y1137H)
Ref Sequence ENSEMBL: ENSMUSP00000049391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040999]
PDB Structure
Crystal structure of the mouse liver Aldehyde Oxidase 3 (mAOX3) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000040999
AA Change: Y1137H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049391
Gene: ENSMUSG00000064294
AA Change: Y1137H

DomainStartEndE-ValueType
Pfam:Fer2 12 82 1.4e-9 PFAM
Pfam:Fer2_2 91 165 1e-29 PFAM
Pfam:FAD_binding_5 239 419 1e-44 PFAM
CO_deh_flav_C 426 530 9.26e-24 SMART
Ald_Xan_dh_C 594 697 2.27e-41 SMART
Pfam:Ald_Xan_dh_C2 708 1241 8.7e-183 PFAM
low complexity region 1275 1286 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,833,748 N568S probably damaging Het
A2m C A 6: 121,654,612 L623M probably benign Het
Abhd2 T C 7: 79,348,356 I212T possibly damaging Het
Adam7 A C 14: 68,512,625 S449A possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Atp11b T C 3: 35,834,325 Y715H probably damaging Het
Atrn A G 2: 130,995,051 Y1145C probably damaging Het
Btbd7 A G 12: 102,793,796 I631T probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cfap45 A G 1: 172,545,112 E458G probably damaging Het
Cptp C T 4: 155,866,538 R157H probably damaging Het
Dcbld1 A C 10: 52,319,651 E318D possibly damaging Het
Ddr2 G T 1: 170,004,245 P197Q probably damaging Het
Dlg5 T C 14: 24,176,571 Y421C probably damaging Het
Dlgap2 A G 8: 14,843,624 K980E probably benign Het
Drc7 T C 8: 95,056,016 V3A unknown Het
Dst T C 1: 34,161,029 V96A probably damaging Het
Ect2l T C 10: 18,143,004 D548G possibly damaging Het
Efcab10 A T 12: 33,398,435 Y89F probably benign Het
Eif1ad CGAGGAGGAGGAGGAGGAGG CGAGGAGGAGGAGGAGG 19: 5,370,058 probably benign Het
Entpd6 A G 2: 150,758,812 T147A probably damaging Het
Fbxl5 T A 5: 43,765,490 E189D probably benign Het
Fer1l6 T A 15: 58,625,231 S1217T probably damaging Het
Frem2 A T 3: 53,653,495 V1197D possibly damaging Het
Fsip2 T A 2: 82,980,783 L2482* probably null Het
Fsip2 A T 2: 82,986,820 D4299V probably benign Het
Gipc3 T A 10: 81,338,215 I242F probably damaging Het
Hoxb1 T A 11: 96,366,112 Y96N probably damaging Het
Ibsp A G 5: 104,310,212 E205G probably damaging Het
Ibtk A G 9: 85,703,082 S1170P probably benign Het
Igfn1 A G 1: 135,966,063 probably null Het
Iqsec1 A G 6: 90,662,895 S954P probably benign Het
Kalrn A T 16: 34,392,093 D28E probably benign Het
Lrmda T C 14: 22,577,870 F52L probably damaging Het
Lrp2 T C 2: 69,523,287 D543G probably damaging Het
Lrrtm3 T C 10: 64,088,378 T337A probably benign Het
Marf1 C T 16: 14,128,601 D1219N possibly damaging Het
Mkln1 A G 6: 31,428,178 K118R probably benign Het
Nedd4l T C 18: 65,167,575 probably null Het
Neu2 A G 1: 87,597,301 E336G probably benign Het
Nfasc A G 1: 132,610,805 F448S probably damaging Het
Nlrx1 C A 9: 44,254,134 E822* probably null Het
Nr5a1 T C 2: 38,694,096 Y437C probably damaging Het
Olfr1224-ps1 A G 2: 89,156,581 V198A probably benign Het
Olfr1353 T A 10: 78,970,141 L164* probably null Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Phtf1 C T 3: 103,969,122 Q13* probably null Het
Pnldc1 A G 17: 12,888,928 L525P possibly damaging Het
Ppl T A 16: 5,106,124 D162V possibly damaging Het
Prkdc T A 16: 15,714,215 S1448T possibly damaging Het
Ptgdr A G 14: 44,853,281 I340T probably benign Het
Recql T C 6: 142,365,589 I458M probably benign Het
Rrbp1 A T 2: 143,988,291 V652E probably benign Het
Rtp1 T A 16: 23,431,410 I175N probably damaging Het
Ryr1 A G 7: 29,054,944 M3523T probably damaging Het
S100a16 T C 3: 90,542,396 L62P probably damaging Het
Samd11 T C 4: 156,248,709 E364G probably damaging Het
Satb1 C A 17: 51,742,115 G603* probably null Het
Shroom3 T A 5: 92,962,365 probably null Het
Slc25a15 A G 8: 22,395,761 S3P probably benign Het
Socs2 A T 10: 95,413,038 L71* probably null Het
Sptbn1 T C 11: 30,104,469 E2208G probably damaging Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Susd1 T A 4: 59,412,191 T121S probably benign Het
Svs3b A T 2: 164,255,928 S158T probably benign Het
Synpo C T 18: 60,603,589 M428I probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar4 A G 10: 23,961,341 D283G probably damaging Het
Tango6 T A 8: 106,688,794 D82E probably benign Het
Tcof1 T C 18: 60,838,855 T127A possibly damaging Het
Tle3 G A 9: 61,411,340 probably null Het
Tmem45a A G 16: 56,822,302 F169L probably benign Het
Trp53rkb T A 2: 166,795,823 V233E probably damaging Het
Ttc7b C T 12: 100,415,130 probably null Het
Tubgcp3 A T 8: 12,621,932 L770* probably null Het
Tut1 G A 19: 8,966,102 G851D probably benign Het
Ubr1 G A 2: 120,930,968 T576I probably benign Het
Vmn1r125 T A 7: 21,272,605 Y143N probably damaging Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Vmn2r95 T A 17: 18,424,313 N70K probably benign Het
Wdr59 A T 8: 111,486,950 L311* probably null Het
Wnt2 A G 6: 18,030,253 L12P unknown Het
Xrn1 T C 9: 95,999,497 I700T probably benign Het
Ypel1 A G 16: 17,082,579 H98R probably benign Het
Zfp219 T C 14: 52,008,234 T434A probably benign Het
Zik1 A C 7: 10,490,016 C385G probably damaging Het
Other mutations in Aox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Aox3 APN 1 58169794 missense probably damaging 1.00
IGL01747:Aox3 APN 1 58159658 missense probably damaging 0.97
IGL01883:Aox3 APN 1 58138283 missense probably damaging 1.00
IGL01911:Aox3 APN 1 58152560 missense probably benign 0.04
IGL02017:Aox3 APN 1 58120992 missense probably damaging 1.00
IGL02120:Aox3 APN 1 58127650 missense probably benign 0.00
IGL02466:Aox3 APN 1 58158272 missense probably benign 0.28
IGL02545:Aox3 APN 1 58183486 missense probably damaging 1.00
IGL02572:Aox3 APN 1 58158367 missense probably damaging 1.00
IGL02746:Aox3 APN 1 58183542 missense possibly damaging 0.83
IGL02808:Aox3 APN 1 58142700 missense probably damaging 0.99
IGL02812:Aox3 APN 1 58165896 missense probably benign 0.00
IGL02982:Aox3 APN 1 58127687 missense probably benign 0.00
IGL03056:Aox3 APN 1 58159021 critical splice donor site probably null
IGL03182:Aox3 APN 1 58165887 missense probably benign 0.02
IGL03234:Aox3 APN 1 58152686 missense probably benign
IGL03374:Aox3 APN 1 58171848 missense probably damaging 1.00
amber UTSW 1 58171891 nonsense probably null
R0071:Aox3 UTSW 1 58171891 nonsense probably null
R0071:Aox3 UTSW 1 58171891 nonsense probably null
R0135:Aox3 UTSW 1 58125088 splice site probably benign
R0332:Aox3 UTSW 1 58142751 missense probably benign 0.00
R0626:Aox3 UTSW 1 58172299 missense possibly damaging 0.94
R1325:Aox3 UTSW 1 58176567 nonsense probably null
R1435:Aox3 UTSW 1 58163446 critical splice donor site probably null
R1438:Aox3 UTSW 1 58153178 missense probably benign
R1567:Aox3 UTSW 1 58194693 missense probably damaging 0.96
R1575:Aox3 UTSW 1 58152554 missense probably benign 0.04
R1759:Aox3 UTSW 1 58170646 splice site probably null
R1785:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R1786:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R1984:Aox3 UTSW 1 58153061 missense possibly damaging 0.88
R2012:Aox3 UTSW 1 58138232 missense probably benign 0.02
R2080:Aox3 UTSW 1 58186280 missense probably benign 0.06
R2121:Aox3 UTSW 1 58152549 splice site probably benign
R2126:Aox3 UTSW 1 58158216 missense probably benign 0.25
R2130:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2131:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2132:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2133:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2385:Aox3 UTSW 1 58138289 missense probably damaging 1.00
R2495:Aox3 UTSW 1 58188408 missense probably damaging 0.99
R4200:Aox3 UTSW 1 58188378 missense probably damaging 1.00
R4231:Aox3 UTSW 1 58114885 missense probably benign 0.12
R4591:Aox3 UTSW 1 58152656 missense probably damaging 0.99
R4627:Aox3 UTSW 1 58125035 missense probably damaging 0.98
R4831:Aox3 UTSW 1 58152566 missense probably damaging 0.97
R4864:Aox3 UTSW 1 58176487 missense probably damaging 1.00
R4976:Aox3 UTSW 1 58188524 critical splice donor site probably null
R5007:Aox3 UTSW 1 58163424 missense probably benign
R5119:Aox3 UTSW 1 58188524 critical splice donor site probably null
R5175:Aox3 UTSW 1 58172328 missense probably benign 0.01
R5360:Aox3 UTSW 1 58146508 missense probably damaging 1.00
R5784:Aox3 UTSW 1 58153499 missense probably benign 0.00
R6050:Aox3 UTSW 1 58180655 missense possibly damaging 0.93
R6056:Aox3 UTSW 1 58169859 missense probably damaging 1.00
R6162:Aox3 UTSW 1 58159731 missense possibly damaging 0.75
R6181:Aox3 UTSW 1 58158946 missense probably benign 0.03
R6374:Aox3 UTSW 1 58172161 missense probably benign 0.11
R6662:Aox3 UTSW 1 58118615 missense probably damaging 1.00
R6809:Aox3 UTSW 1 58118681 missense probably damaging 0.99
R6810:Aox3 UTSW 1 58141431 missense probably benign 0.00
R6821:Aox3 UTSW 1 58150388 missense probably benign 0.04
R7039:Aox3 UTSW 1 58176555 missense probably damaging 1.00
R7116:Aox3 UTSW 1 58153530 missense probably benign 0.01
R7146:Aox3 UTSW 1 58158529 intron probably null
R7163:Aox3 UTSW 1 58119512 missense probably damaging 0.99
R7243:Aox3 UTSW 1 58138307 missense unknown
R7319:Aox3 UTSW 1 58152602 missense probably benign 0.04
R7423:Aox3 UTSW 1 58121069 missense possibly damaging 0.80
R7664:Aox3 UTSW 1 58119539 missense probably damaging 1.00
R7709:Aox3 UTSW 1 58180651 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTCACCTGACAGTATGCTCC -3'
(R):5'- TTGCATTTAGGAAACTGTGGGAC -3'

Sequencing Primer
(F):5'- GCTCCATATTCATCTTGCAAAGAC -3'
(R):5'- TAGGAAACTGTGGGACTCATCTC -3'
Posted On2014-07-14