Incidental Mutation 'R1921:Nfasc'
ID213015
Institutional Source Beutler Lab
Gene Symbol Nfasc
Ensembl Gene ENSMUSG00000026442
Gene Nameneurofascin
SynonymsD430023G06Rik
MMRRC Submission 039939-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1921 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location132564690-132741797 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 132610805 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 448 (F448S)
Ref Sequence ENSEMBL: ENSMUSP00000139520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043189] [ENSMUST00000094569] [ENSMUST00000163770] [ENSMUST00000187861] [ENSMUST00000188307]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043189
AA Change: F448S

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000035454
Gene: ENSMUSG00000026442
AA Change: F448S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 42 131 4.5e0 SMART
IG 141 228 2.44e-7 SMART
IGc2 253 317 1.53e-17 SMART
IGc2 343 409 1.76e-8 SMART
IGc2 437 502 2.39e-10 SMART
IGc2 528 593 2.54e-5 SMART
FN3 607 690 2.17e-11 SMART
FN3 707 789 2.85e-6 SMART
FN3 805 896 2.21e-3 SMART
FN3 911 995 9.92e-6 SMART
low complexity region 996 1018 N/A INTRINSIC
transmembrane domain 1026 1048 N/A INTRINSIC
Pfam:Bravo_FIGEY 1049 1133 1.4e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094569
AA Change: F454S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092148
Gene: ENSMUSG00000026442
AA Change: F454S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 48 137 4.5e0 SMART
IG 147 234 2.44e-7 SMART
IGc2 259 323 1.53e-17 SMART
IGc2 349 415 1.76e-8 SMART
IGc2 443 508 2.39e-10 SMART
IGc2 534 599 2.54e-5 SMART
FN3 628 711 2.17e-11 SMART
FN3 728 810 2.85e-6 SMART
FN3 825 909 9.92e-6 SMART
FN3 1010 1086 6.91e-5 SMART
transmembrane domain 1109 1131 N/A INTRINSIC
Pfam:Bravo_FIGEY 1132 1216 2.2e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163770
AA Change: F465S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132979
Gene: ENSMUSG00000026442
AA Change: F465S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 42 131 4.5e0 SMART
IG 141 228 2.44e-7 SMART
IGc2 270 334 1.53e-17 SMART
IGc2 360 426 1.76e-8 SMART
IGc2 454 519 2.39e-10 SMART
IGc2 545 610 2.54e-5 SMART
FN3 624 707 2.17e-11 SMART
FN3 724 806 2.85e-6 SMART
FN3 822 913 2.21e-3 SMART
FN3 928 1012 9.92e-6 SMART
low complexity region 1013 1035 N/A INTRINSIC
transmembrane domain 1043 1065 N/A INTRINSIC
Pfam:Bravo_FIGEY 1066 1150 5e-30 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000186389
AA Change: F434S
Predicted Effect probably damaging
Transcript: ENSMUST00000187861
AA Change: F454S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139955
Gene: ENSMUSG00000026442
AA Change: F454S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 48 137 1.8e-2 SMART
IG 147 234 1e-9 SMART
IGc2 259 323 6.4e-20 SMART
IGc2 349 415 7e-11 SMART
IGc2 443 508 9.7e-13 SMART
IGc2 534 599 1.1e-7 SMART
FN3 628 711 1e-13 SMART
FN3 728 810 1.4e-8 SMART
FN3 826 917 1.1e-5 SMART
FN3 932 1016 4.8e-8 SMART
FN3 1117 1193 3.4e-7 SMART
transmembrane domain 1216 1238 N/A INTRINSIC
Pfam:Bravo_FIGEY 1239 1325 2.6e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000188307
AA Change: F448S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139520
Gene: ENSMUSG00000026442
AA Change: F448S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 42 131 1.8e-2 SMART
IG 141 228 1e-9 SMART
IGc2 253 317 6.4e-20 SMART
IGc2 343 409 7e-11 SMART
IGc2 437 502 9.7e-13 SMART
IGc2 528 593 1.1e-7 SMART
FN3 622 705 1e-13 SMART
FN3 722 804 1.4e-8 SMART
FN3 820 890 3.8e-1 SMART
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an L1 family immunoglobulin cell adhesion molecule with multiple IGcam and fibronectin domains. The protein functions in neurite outgrowth, neurite fasciculation, and organization of the axon initial segment (AIS) and nodes of Ranvier on axons during early development. Both the AIS and nodes of Ranvier contain high densities of voltage-gated Na+ (Nav) channels which are clustered by interactions with cytoskeletal and scaffolding proteins including this protein, gliomedin, ankyrin 3 (ankyrin-G), and betaIV spectrin. This protein links the AIS extracellular matrix to the intracellular cytoskeleton. This gene undergoes extensive alternative splicing, and the full-length nature of some variants has not been determined. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a null allele die within 6 to 7 days of birth, exhibit reduced nerve conduction velocity and abnormal paranodal junction formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,833,748 N568S probably damaging Het
A2m C A 6: 121,654,612 L623M probably benign Het
Abhd2 T C 7: 79,348,356 I212T possibly damaging Het
Adam7 A C 14: 68,512,625 S449A possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aox3 T C 1: 58,180,651 Y1137H probably damaging Het
Atp11b T C 3: 35,834,325 Y715H probably damaging Het
Atrn A G 2: 130,995,051 Y1145C probably damaging Het
Btbd7 A G 12: 102,793,796 I631T probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cfap45 A G 1: 172,545,112 E458G probably damaging Het
Cptp C T 4: 155,866,538 R157H probably damaging Het
Dcbld1 A C 10: 52,319,651 E318D possibly damaging Het
Ddr2 G T 1: 170,004,245 P197Q probably damaging Het
Dlg5 T C 14: 24,176,571 Y421C probably damaging Het
Dlgap2 A G 8: 14,843,624 K980E probably benign Het
Drc7 T C 8: 95,056,016 V3A unknown Het
Dst T C 1: 34,161,029 V96A probably damaging Het
Ect2l T C 10: 18,143,004 D548G possibly damaging Het
Efcab10 A T 12: 33,398,435 Y89F probably benign Het
Eif1ad CGAGGAGGAGGAGGAGGAGG CGAGGAGGAGGAGGAGG 19: 5,370,058 probably benign Het
Entpd6 A G 2: 150,758,812 T147A probably damaging Het
Fbxl5 T A 5: 43,765,490 E189D probably benign Het
Fer1l6 T A 15: 58,625,231 S1217T probably damaging Het
Frem2 A T 3: 53,653,495 V1197D possibly damaging Het
Fsip2 T A 2: 82,980,783 L2482* probably null Het
Fsip2 A T 2: 82,986,820 D4299V probably benign Het
Gipc3 T A 10: 81,338,215 I242F probably damaging Het
Hoxb1 T A 11: 96,366,112 Y96N probably damaging Het
Ibsp A G 5: 104,310,212 E205G probably damaging Het
Ibtk A G 9: 85,703,082 S1170P probably benign Het
Igfn1 A G 1: 135,966,063 probably null Het
Iqsec1 A G 6: 90,662,895 S954P probably benign Het
Kalrn A T 16: 34,392,093 D28E probably benign Het
Lrmda T C 14: 22,577,870 F52L probably damaging Het
Lrp2 T C 2: 69,523,287 D543G probably damaging Het
Lrrtm3 T C 10: 64,088,378 T337A probably benign Het
Marf1 C T 16: 14,128,601 D1219N possibly damaging Het
Mkln1 A G 6: 31,428,178 K118R probably benign Het
Nedd4l T C 18: 65,167,575 probably null Het
Neu2 A G 1: 87,597,301 E336G probably benign Het
Nlrx1 C A 9: 44,254,134 E822* probably null Het
Nr5a1 T C 2: 38,694,096 Y437C probably damaging Het
Olfr1224-ps1 A G 2: 89,156,581 V198A probably benign Het
Olfr1353 T A 10: 78,970,141 L164* probably null Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Phtf1 C T 3: 103,969,122 Q13* probably null Het
Pnldc1 A G 17: 12,888,928 L525P possibly damaging Het
Ppl T A 16: 5,106,124 D162V possibly damaging Het
Prkdc T A 16: 15,714,215 S1448T possibly damaging Het
Ptgdr A G 14: 44,853,281 I340T probably benign Het
Recql T C 6: 142,365,589 I458M probably benign Het
Rrbp1 A T 2: 143,988,291 V652E probably benign Het
Rtp1 T A 16: 23,431,410 I175N probably damaging Het
Ryr1 A G 7: 29,054,944 M3523T probably damaging Het
S100a16 T C 3: 90,542,396 L62P probably damaging Het
Samd11 T C 4: 156,248,709 E364G probably damaging Het
Satb1 C A 17: 51,742,115 G603* probably null Het
Shroom3 T A 5: 92,962,365 probably null Het
Slc25a15 A G 8: 22,395,761 S3P probably benign Het
Socs2 A T 10: 95,413,038 L71* probably null Het
Sptbn1 T C 11: 30,104,469 E2208G probably damaging Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Susd1 T A 4: 59,412,191 T121S probably benign Het
Svs3b A T 2: 164,255,928 S158T probably benign Het
Synpo C T 18: 60,603,589 M428I probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar4 A G 10: 23,961,341 D283G probably damaging Het
Tango6 T A 8: 106,688,794 D82E probably benign Het
Tcof1 T C 18: 60,838,855 T127A possibly damaging Het
Tle3 G A 9: 61,411,340 probably null Het
Tmem45a A G 16: 56,822,302 F169L probably benign Het
Trp53rkb T A 2: 166,795,823 V233E probably damaging Het
Ttc7b C T 12: 100,415,130 probably null Het
Tubgcp3 A T 8: 12,621,932 L770* probably null Het
Tut1 G A 19: 8,966,102 G851D probably benign Het
Ubr1 G A 2: 120,930,968 T576I probably benign Het
Vmn1r125 T A 7: 21,272,605 Y143N probably damaging Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Vmn2r95 T A 17: 18,424,313 N70K probably benign Het
Wdr59 A T 8: 111,486,950 L311* probably null Het
Wnt2 A G 6: 18,030,253 L12P unknown Het
Xrn1 T C 9: 95,999,497 I700T probably benign Het
Ypel1 A G 16: 17,082,579 H98R probably benign Het
Zfp219 T C 14: 52,008,234 T434A probably benign Het
Zik1 A C 7: 10,490,016 C385G probably damaging Het
Other mutations in Nfasc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Nfasc APN 1 132573798 nonsense probably null
IGL01088:Nfasc APN 1 132642776 utr 5 prime probably benign
IGL01958:Nfasc APN 1 132608438 nonsense probably null
IGL01999:Nfasc APN 1 132605247 splice site probably benign
IGL02170:Nfasc APN 1 132610366 nonsense probably null
IGL02187:Nfasc APN 1 132570481 missense probably damaging 1.00
IGL02192:Nfasc APN 1 132570481 missense probably damaging 1.00
IGL02452:Nfasc APN 1 132620924 critical splice donor site probably null
IGL02698:Nfasc APN 1 132634737 missense probably benign 0.06
IGL02797:Nfasc APN 1 132610448 missense probably damaging 1.00
IGL03000:Nfasc APN 1 132621509 splice site probably benign
IGL03027:Nfasc APN 1 132610469 missense probably damaging 1.00
jiggle UTSW 1 132602021 missense probably damaging 1.00
Tremble UTSW 1 132611595 missense probably damaging 1.00
PIT4377001:Nfasc UTSW 1 132583066 missense unknown
R0240:Nfasc UTSW 1 132601983 missense probably damaging 1.00
R0240:Nfasc UTSW 1 132601983 missense probably damaging 1.00
R0241:Nfasc UTSW 1 132636993 missense probably benign 0.02
R0241:Nfasc UTSW 1 132636993 missense probably benign 0.02
R0418:Nfasc UTSW 1 132611595 missense probably damaging 1.00
R0513:Nfasc UTSW 1 132603846 missense possibly damaging 0.95
R0639:Nfasc UTSW 1 132603816 missense probably damaging 1.00
R0646:Nfasc UTSW 1 132608438 nonsense probably null
R1103:Nfasc UTSW 1 132607057 splice site probably benign
R1269:Nfasc UTSW 1 132610788 missense probably damaging 1.00
R1550:Nfasc UTSW 1 132608503 missense probably damaging 0.96
R1749:Nfasc UTSW 1 132611632 missense probably damaging 1.00
R1773:Nfasc UTSW 1 132610839 missense probably damaging 1.00
R1987:Nfasc UTSW 1 132610886 missense probably damaging 1.00
R2141:Nfasc UTSW 1 132596645 missense probably damaging 1.00
R2239:Nfasc UTSW 1 132583022 intron probably benign
R2413:Nfasc UTSW 1 132595505 missense probably damaging 1.00
R2428:Nfasc UTSW 1 132595654 missense possibly damaging 0.55
R2472:Nfasc UTSW 1 132588221 intron probably benign
R2517:Nfasc UTSW 1 132597763 splice site probably null
R3850:Nfasc UTSW 1 132631733 missense probably damaging 1.00
R4050:Nfasc UTSW 1 132610305 splice site probably benign
R4061:Nfasc UTSW 1 132597845 missense probably damaging 1.00
R4088:Nfasc UTSW 1 132595591 missense probably damaging 1.00
R4342:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4343:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4345:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4452:Nfasc UTSW 1 132634671 missense probably damaging 1.00
R4818:Nfasc UTSW 1 132603830 missense possibly damaging 0.87
R4851:Nfasc UTSW 1 132602021 missense probably damaging 1.00
R5014:Nfasc UTSW 1 132584447 intron probably benign
R5768:Nfasc UTSW 1 132605145 missense probably benign 0.00
R6145:Nfasc UTSW 1 132634717 missense probably damaging 1.00
R6335:Nfasc UTSW 1 132576394 missense probably damaging 0.98
R6379:Nfasc UTSW 1 132570542 nonsense probably null
R6486:Nfasc UTSW 1 132605214 missense probably damaging 1.00
R7022:Nfasc UTSW 1 132621049 missense probably damaging 1.00
R7062:Nfasc UTSW 1 132601969 critical splice donor site probably null
R7084:Nfasc UTSW 1 132570509 missense unknown
R7275:Nfasc UTSW 1 132634263 missense probably damaging 1.00
R7286:Nfasc UTSW 1 132602052 missense probably damaging 1.00
R7682:Nfasc UTSW 1 132573773 missense unknown
R7838:Nfasc UTSW 1 132605549 missense probably damaging 1.00
R7871:Nfasc UTSW 1 132600013 missense not run
R7938:Nfasc UTSW 1 132605531 missense probably damaging 1.00
R8083:Nfasc UTSW 1 132596582 missense probably benign 0.00
Z1176:Nfasc UTSW 1 132634638 missense probably benign 0.00
Z1177:Nfasc UTSW 1 132631838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCCTCTGAACAATATTGGG -3'
(R):5'- GTTTCCCTTAGACGAGGCTTG -3'

Sequencing Primer
(F):5'- CTCTGAACAATATTGGGTTCACC -3'
(R):5'- TTCCCTTAGACGAGGCTTGTAAAAGG -3'
Posted On2014-07-14