Incidental Mutation 'R1921:Ddr2'
ID213017
Institutional Source Beutler Lab
Gene Symbol Ddr2
Ensembl Gene ENSMUSG00000026674
Gene Namediscoidin domain receptor family, member 2
SynonymsNtrkr3
MMRRC Submission 039939-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1921 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location169972307-170110762 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 170004245 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 197 (P197Q)
Ref Sequence ENSEMBL: ENSMUSP00000141443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027985] [ENSMUST00000170800] [ENSMUST00000192312] [ENSMUST00000194690]
Predicted Effect probably damaging
Transcript: ENSMUST00000027985
AA Change: P197Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027985
Gene: ENSMUSG00000026674
AA Change: P197Q

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
FA58C 29 185 2.39e-43 SMART
transmembrane domain 400 422 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
TyrKc 563 848 1.08e-133 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170800
AA Change: P197Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129624
Gene: ENSMUSG00000026674
AA Change: P197Q

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
FA58C 29 185 2.39e-43 SMART
transmembrane domain 400 422 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
TyrKc 563 848 1.08e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192312
SMART Domains Protein: ENSMUSP00000142191
Gene: ENSMUSG00000026674

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FA58C 29 129 7e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000194690
AA Change: P197Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141443
Gene: ENSMUSG00000026674
AA Change: P197Q

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
FA58C 29 185 2.39e-43 SMART
transmembrane domain 400 422 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
TyrKc 563 848 1.08e-133 SMART
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Receptor tyrosine kinases (RTKs) play a key role in the communication of cells with their microenvironment. These molecules are involved in the regulation of cell growth, differentiation, and metabolism. In several cases the biochemical mechanism by which RTKs transduce signals across the membrane has been shown to be ligand induced receptor oligomerization and subsequent intracellular phosphorylation. This autophosphorylation leads to phosphorylation of cytosolic targets as well as association with other molecules, which are involved in pleiotropic effects of signal transduction. RTKs have a tripartite structure with extracellular, transmembrane, and cytoplasmic regions. This gene encodes a member of a novel subclass of RTKs and contains a distinct extracellular region encompassing a factor VIII-like domain. Alternative splicing in the 5' UTR results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show dwarfism, reduced chondrocyte proliferation, shortened long bones and snout, and skull anomalies. Homozygotes for another null allele show similar skeletal defects, small hearts, short cardiomyocytes, lower cardiac collagen density, and altered cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,833,748 N568S probably damaging Het
A2m C A 6: 121,654,612 L623M probably benign Het
Abhd2 T C 7: 79,348,356 I212T possibly damaging Het
Adam7 A C 14: 68,512,625 S449A possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aox3 T C 1: 58,180,651 Y1137H probably damaging Het
Atp11b T C 3: 35,834,325 Y715H probably damaging Het
Atrn A G 2: 130,995,051 Y1145C probably damaging Het
Btbd7 A G 12: 102,793,796 I631T probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cfap45 A G 1: 172,545,112 E458G probably damaging Het
Cptp C T 4: 155,866,538 R157H probably damaging Het
Dcbld1 A C 10: 52,319,651 E318D possibly damaging Het
Dlg5 T C 14: 24,176,571 Y421C probably damaging Het
Dlgap2 A G 8: 14,843,624 K980E probably benign Het
Drc7 T C 8: 95,056,016 V3A unknown Het
Dst T C 1: 34,161,029 V96A probably damaging Het
Ect2l T C 10: 18,143,004 D548G possibly damaging Het
Efcab10 A T 12: 33,398,435 Y89F probably benign Het
Eif1ad CGAGGAGGAGGAGGAGGAGG CGAGGAGGAGGAGGAGG 19: 5,370,058 probably benign Het
Entpd6 A G 2: 150,758,812 T147A probably damaging Het
Fbxl5 T A 5: 43,765,490 E189D probably benign Het
Fer1l6 T A 15: 58,625,231 S1217T probably damaging Het
Frem2 A T 3: 53,653,495 V1197D possibly damaging Het
Fsip2 T A 2: 82,980,783 L2482* probably null Het
Fsip2 A T 2: 82,986,820 D4299V probably benign Het
Gipc3 T A 10: 81,338,215 I242F probably damaging Het
Hoxb1 T A 11: 96,366,112 Y96N probably damaging Het
Ibsp A G 5: 104,310,212 E205G probably damaging Het
Ibtk A G 9: 85,703,082 S1170P probably benign Het
Igfn1 A G 1: 135,966,063 probably null Het
Iqsec1 A G 6: 90,662,895 S954P probably benign Het
Kalrn A T 16: 34,392,093 D28E probably benign Het
Lrmda T C 14: 22,577,870 F52L probably damaging Het
Lrp2 T C 2: 69,523,287 D543G probably damaging Het
Lrrtm3 T C 10: 64,088,378 T337A probably benign Het
Marf1 C T 16: 14,128,601 D1219N possibly damaging Het
Mkln1 A G 6: 31,428,178 K118R probably benign Het
Nedd4l T C 18: 65,167,575 probably null Het
Neu2 A G 1: 87,597,301 E336G probably benign Het
Nfasc A G 1: 132,610,805 F448S probably damaging Het
Nlrx1 C A 9: 44,254,134 E822* probably null Het
Nr5a1 T C 2: 38,694,096 Y437C probably damaging Het
Olfr1224-ps1 A G 2: 89,156,581 V198A probably benign Het
Olfr1353 T A 10: 78,970,141 L164* probably null Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Phtf1 C T 3: 103,969,122 Q13* probably null Het
Pnldc1 A G 17: 12,888,928 L525P possibly damaging Het
Ppl T A 16: 5,106,124 D162V possibly damaging Het
Prkdc T A 16: 15,714,215 S1448T possibly damaging Het
Ptgdr A G 14: 44,853,281 I340T probably benign Het
Recql T C 6: 142,365,589 I458M probably benign Het
Rrbp1 A T 2: 143,988,291 V652E probably benign Het
Rtp1 T A 16: 23,431,410 I175N probably damaging Het
Ryr1 A G 7: 29,054,944 M3523T probably damaging Het
S100a16 T C 3: 90,542,396 L62P probably damaging Het
Samd11 T C 4: 156,248,709 E364G probably damaging Het
Satb1 C A 17: 51,742,115 G603* probably null Het
Shroom3 T A 5: 92,962,365 probably null Het
Slc25a15 A G 8: 22,395,761 S3P probably benign Het
Socs2 A T 10: 95,413,038 L71* probably null Het
Sptbn1 T C 11: 30,104,469 E2208G probably damaging Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Susd1 T A 4: 59,412,191 T121S probably benign Het
Svs3b A T 2: 164,255,928 S158T probably benign Het
Synpo C T 18: 60,603,589 M428I probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar4 A G 10: 23,961,341 D283G probably damaging Het
Tango6 T A 8: 106,688,794 D82E probably benign Het
Tcof1 T C 18: 60,838,855 T127A possibly damaging Het
Tle3 G A 9: 61,411,340 probably null Het
Tmem45a A G 16: 56,822,302 F169L probably benign Het
Trp53rkb T A 2: 166,795,823 V233E probably damaging Het
Ttc7b C T 12: 100,415,130 probably null Het
Tubgcp3 A T 8: 12,621,932 L770* probably null Het
Tut1 G A 19: 8,966,102 G851D probably benign Het
Ubr1 G A 2: 120,930,968 T576I probably benign Het
Vmn1r125 T A 7: 21,272,605 Y143N probably damaging Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Vmn2r95 T A 17: 18,424,313 N70K probably benign Het
Wdr59 A T 8: 111,486,950 L311* probably null Het
Wnt2 A G 6: 18,030,253 L12P unknown Het
Xrn1 T C 9: 95,999,497 I700T probably benign Het
Ypel1 A G 16: 17,082,579 H98R probably benign Het
Zfp219 T C 14: 52,008,234 T434A probably benign Het
Zik1 A C 7: 10,490,016 C385G probably damaging Het
Other mutations in Ddr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ddr2 APN 1 169984427 missense possibly damaging 0.95
IGL00432:Ddr2 APN 1 169997958 missense probably benign 0.11
IGL00490:Ddr2 APN 1 170005194 missense probably damaging 1.00
IGL01343:Ddr2 APN 1 169984581 missense probably benign
IGL01898:Ddr2 APN 1 169998156 missense possibly damaging 0.85
IGL01899:Ddr2 APN 1 169984422 missense probably damaging 1.00
IGL01906:Ddr2 APN 1 169982099 missense probably damaging 1.00
IGL02115:Ddr2 APN 1 169994709 missense probably benign
IGL02330:Ddr2 APN 1 169988524 missense probably damaging 0.99
IGL02740:Ddr2 APN 1 169984945 missense probably damaging 1.00
IGL02828:Ddr2 APN 1 169988513 missense probably benign 0.34
built UTSW 1 169997964 missense probably damaging 1.00
debulked UTSW 1 169982098 missense probably damaging 1.00
fibro UTSW 1 170004812 splice site probably benign
fingers UTSW 1 169988540 missense probably benign 0.16
Julio UTSW 1 169997929 critical splice donor site probably null
phalanges UTSW 1 170005240 nonsense probably null
revolta UTSW 1 169988520 nonsense probably null
R0574:Ddr2 UTSW 1 169981963 splice site probably benign
R0730:Ddr2 UTSW 1 169995566 missense probably benign
R0733:Ddr2 UTSW 1 170004812 splice site probably benign
R0883:Ddr2 UTSW 1 169994629 missense probably benign 0.01
R1340:Ddr2 UTSW 1 169998084 missense probably benign
R1815:Ddr2 UTSW 1 169995601 nonsense probably null
R1924:Ddr2 UTSW 1 169982072 missense probably benign 0.01
R2016:Ddr2 UTSW 1 169984968 missense probably damaging 1.00
R2079:Ddr2 UTSW 1 170004776 nonsense probably null
R2178:Ddr2 UTSW 1 169994682 missense probably benign 0.18
R2903:Ddr2 UTSW 1 169998161 missense probably damaging 1.00
R3051:Ddr2 UTSW 1 169988455 missense probably benign 0.01
R3971:Ddr2 UTSW 1 169988417 missense probably damaging 1.00
R4290:Ddr2 UTSW 1 169990609 missense probably benign 0.00
R4494:Ddr2 UTSW 1 169988414 missense probably damaging 1.00
R4606:Ddr2 UTSW 1 170001852 missense probably benign 0.05
R4721:Ddr2 UTSW 1 170005240 nonsense probably null
R4734:Ddr2 UTSW 1 169998088 missense probably benign 0.41
R4855:Ddr2 UTSW 1 169988497 missense possibly damaging 0.94
R4871:Ddr2 UTSW 1 170004771 missense probably benign 0.19
R4923:Ddr2 UTSW 1 169997929 critical splice donor site probably null
R5207:Ddr2 UTSW 1 169984961 missense probably damaging 1.00
R5325:Ddr2 UTSW 1 170001837 missense probably benign 0.00
R5439:Ddr2 UTSW 1 170004729 missense possibly damaging 0.92
R5723:Ddr2 UTSW 1 169988520 nonsense probably null
R5833:Ddr2 UTSW 1 170004696 missense probably benign 0.01
R5924:Ddr2 UTSW 1 169994628 missense probably benign 0.03
R6020:Ddr2 UTSW 1 170005102 missense probably benign 0.15
R6270:Ddr2 UTSW 1 169988540 missense probably benign 0.16
R6326:Ddr2 UTSW 1 169987140 missense probably damaging 1.00
R6328:Ddr2 UTSW 1 169987065 missense possibly damaging 0.52
R6794:Ddr2 UTSW 1 169982098 missense probably damaging 1.00
R6925:Ddr2 UTSW 1 169998132 missense probably benign 0.01
R7011:Ddr2 UTSW 1 169982103 missense probably damaging 1.00
R7185:Ddr2 UTSW 1 169987054 missense probably damaging 1.00
R7248:Ddr2 UTSW 1 169994629 missense probably benign 0.01
R7278:Ddr2 UTSW 1 169984961 missense probably damaging 1.00
R7343:Ddr2 UTSW 1 169982078 missense probably damaging 1.00
R7366:Ddr2 UTSW 1 169997964 missense probably damaging 1.00
R7520:Ddr2 UTSW 1 169984439 missense probably damaging 1.00
R7571:Ddr2 UTSW 1 170001851 missense probably benign 0.05
R7611:Ddr2 UTSW 1 169998158 missense possibly damaging 0.73
X0004:Ddr2 UTSW 1 169987098 missense probably benign 0.10
X0027:Ddr2 UTSW 1 169982030 missense probably damaging 1.00
Z1176:Ddr2 UTSW 1 169984955 missense probably damaging 1.00
Z1176:Ddr2 UTSW 1 169998083 missense probably benign
Z1176:Ddr2 UTSW 1 169998084 missense probably benign
Z1177:Ddr2 UTSW 1 169990622 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AATACTGGTGGATTGACTGACTCTTTG -3'
(R):5'- TGCCCTGTGGTGGAAATGAC -3'

Sequencing Primer
(F):5'- TGACTGACTCTTTGATTATTGATGG -3'
(R):5'- CCCTGTGGTGGAAATGACATATTCAG -3'
Posted On2014-07-14