Mutagenetix > Incidental Mutation

Incidental Mutation 'R1921:Atrn'

213027

Institutional Source

Beutler Lab

Gene Symbol

Atrn

Ensembl Gene

ENSMUSG00000027312

Gene Name

attractin

Synonyms

Mgca

MMRRC Submission

039939-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1921 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

130906495-131030333 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 130995051 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1145 (Y1145C)

Ref Sequence

ENSEMBL: ENSMUSP00000028781 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028781]

AlphaFold

Q9WU60

Predicted Effect

probably damaging
Transcript: ENSMUST00000028781
AA Change: Y1145C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: Y1145C

Domain	Start	End	E-Value	Type
low complexity region	2	9	N/A	INTRINSIC
low complexity region	51	97	N/A	INTRINSIC
EGF	99	129	9.85e-5	SMART
CUB	131	247	7.85e-18	SMART
EGF	248	282	1.47e1	SMART
Pfam:Kelch_1	339	382	1.1e-7	PFAM
Pfam:Kelch_5	389	434	2.5e-7	PFAM
Pfam:Kelch_6	390	439	3.3e-8	PFAM
Pfam:Kelch_1	553	606	8.4e-8	PFAM
PSI	646	693	7.41e-7	SMART
PSI	702	747	8.64e-8	SMART
PSI	754	799	2.11e-2	SMART
CLECT	787	918	6.14e-20	SMART
PSI	931	982	1.11e-5	SMART
PSI	985	1060	1.2e-6	SMART
EGF_Lam	1062	1105	1.97e-4	SMART
EGF_like	1108	1154	3.9e0	SMART
transmembrane domain	1278	1300	N/A	INTRINSIC
low complexity region	1310	1322	N/A	INTRINSIC
low complexity region	1373	1385	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132557

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134964

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151364

Meta Mutation Damage Score

0.9433

Coding Region Coverage

1x: 97.3%
3x: 96.7%
10x: 94.9%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	A	G	7: 118,833,748	N568S	probably damaging	Het
A2m	C	A	6: 121,654,612	L623M	probably benign	Het
Abhd2	T	C	7: 79,348,356	I212T	possibly damaging	Het
Adam7	A	C	14: 68,512,625	S449A	possibly damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Aox3	T	C	1: 58,180,651	Y1137H	probably damaging	Het
Atp11b	T	C	3: 35,834,325	Y715H	probably damaging	Het
Btbd7	A	G	12: 102,793,796	I631T	probably benign	Het
Cadps	T	C	14: 12,465,859	K1017R	possibly damaging	Het
Cfap45	A	G	1: 172,545,112	E458G	probably damaging	Het
Cptp	C	T	4: 155,866,538	R157H	probably damaging	Het
Dcbld1	A	C	10: 52,319,651	E318D	possibly damaging	Het
Ddr2	G	T	1: 170,004,245	P197Q	probably damaging	Het
Dlg5	T	C	14: 24,176,571	Y421C	probably damaging	Het
Dlgap2	A	G	8: 14,843,624	K980E	probably benign	Het
Drc7	T	C	8: 95,056,016	V3A	unknown	Het
Dst	T	C	1: 34,161,029	V96A	probably damaging	Het
Ect2l	T	C	10: 18,143,004	D548G	possibly damaging	Het
Efcab10	A	T	12: 33,398,435	Y89F	probably benign	Het
Eif1ad	CGAGGAGGAGGAGGAGGAGG	CGAGGAGGAGGAGGAGG	19: 5,370,058		probably benign	Het
Entpd6	A	G	2: 150,758,812	T147A	probably damaging	Het
Fbxl5	T	A	5: 43,765,490	E189D	probably benign	Het
Fer1l6	T	A	15: 58,625,231	S1217T	probably damaging	Het
Frem2	A	T	3: 53,653,495	V1197D	possibly damaging	Het
Fsip2	T	A	2: 82,980,783	L2482*	probably null	Het
Fsip2	A	T	2: 82,986,820	D4299V	probably benign	Het
Gipc3	T	A	10: 81,338,215	I242F	probably damaging	Het
Hoxb1	T	A	11: 96,366,112	Y96N	probably damaging	Het
Ibsp	A	G	5: 104,310,212	E205G	probably damaging	Het
Ibtk	A	G	9: 85,703,082	S1170P	probably benign	Het
Igfn1	A	G	1: 135,966,063		probably null	Het
Iqsec1	A	G	6: 90,662,895	S954P	probably benign	Het
Kalrn	A	T	16: 34,392,093	D28E	probably benign	Het
Lrmda	T	C	14: 22,577,870	F52L	probably damaging	Het
Lrp2	T	C	2: 69,523,287	D543G	probably damaging	Het
Lrrtm3	T	C	10: 64,088,378	T337A	probably benign	Het
Marf1	C	T	16: 14,128,601	D1219N	possibly damaging	Het
Mkln1	A	G	6: 31,428,178	K118R	probably benign	Het
Nedd4l	T	C	18: 65,167,575		probably null	Het
Neu2	A	G	1: 87,597,301	E336G	probably benign	Het
Nfasc	A	G	1: 132,610,805	F448S	probably damaging	Het
Nlrx1	C	A	9: 44,254,134	E822*	probably null	Het
Nr5a1	T	C	2: 38,694,096	Y437C	probably damaging	Het
Olfr1224-ps1	A	G	2: 89,156,581	V198A	probably benign	Het
Olfr1353	T	A	10: 78,970,141	L164*	probably null	Het
Olfr885	T	C	9: 38,061,685	Y122H	probably damaging	Het
Phtf1	C	T	3: 103,969,122	Q13*	probably null	Het
Pnldc1	A	G	17: 12,888,928	L525P	possibly damaging	Het
Ppl	T	A	16: 5,106,124	D162V	possibly damaging	Het
Prkdc	T	A	16: 15,714,215	S1448T	possibly damaging	Het
Ptgdr	A	G	14: 44,853,281	I340T	probably benign	Het
Recql	T	C	6: 142,365,589	I458M	probably benign	Het
Rrbp1	A	T	2: 143,988,291	V652E	probably benign	Het
Rtp1	T	A	16: 23,431,410	I175N	probably damaging	Het
Ryr1	A	G	7: 29,054,944	M3523T	probably damaging	Het
S100a16	T	C	3: 90,542,396	L62P	probably damaging	Het
Samd11	T	C	4: 156,248,709	E364G	probably damaging	Het
Satb1	C	A	17: 51,742,115	G603*	probably null	Het
Shroom3	T	A	5: 92,962,365		probably null	Het
Slc25a15	A	G	8: 22,395,761	S3P	probably benign	Het
Socs2	A	T	10: 95,413,038	L71*	probably null	Het
Sptbn1	T	C	11: 30,104,469	E2208G	probably damaging	Het
St14	A	G	9: 31,089,870	V855A	possibly damaging	Het
Susd1	T	A	4: 59,412,191	T121S	probably benign	Het
Svs3b	A	T	2: 164,255,928	S158T	probably benign	Het
Synpo	C	T	18: 60,603,589	M428I	probably benign	Het
Syt10	C	T	15: 89,790,776	D456N	probably damaging	Het
Taar4	A	G	10: 23,961,341	D283G	probably damaging	Het
Tango6	T	A	8: 106,688,794	D82E	probably benign	Het
Tcof1	T	C	18: 60,838,855	T127A	possibly damaging	Het
Tle3	G	A	9: 61,411,340		probably null	Het
Tmem45a	A	G	16: 56,822,302	F169L	probably benign	Het
Trp53rkb	T	A	2: 166,795,823	V233E	probably damaging	Het
Ttc7b	C	T	12: 100,415,130		probably null	Het
Tubgcp3	A	T	8: 12,621,932	L770*	probably null	Het
Tut1	G	A	19: 8,966,102	G851D	probably benign	Het
Ubr1	G	A	2: 120,930,968	T576I	probably benign	Het
Vmn1r125	T	A	7: 21,272,605	Y143N	probably damaging	Het
Vmn2r120	T	A	17: 57,524,839	I317F	probably benign	Het
Vmn2r95	T	A	17: 18,424,313	N70K	probably benign	Het
Wdr59	A	T	8: 111,486,950	L311*	probably null	Het
Wnt2	A	G	6: 18,030,253	L12P	unknown	Het
Xrn1	T	C	9: 95,999,497	I700T	probably benign	Het
Ypel1	A	G	16: 17,082,579	H98R	probably benign	Het
Zfp219	T	C	14: 52,008,234	T434A	probably benign	Het
Zik1	A	C	7: 10,490,016	C385G	probably damaging	Het

Other mutations in Atrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Atrn	APN	2	130958079	missense	probably damaging	1.00
IGL00571:Atrn	APN	2	130995048	missense	probably damaging	1.00
IGL01092:Atrn	APN	2	130947636	nonsense	probably null
IGL01572:Atrn	APN	2	131002795	missense	probably damaging	1.00
IGL01924:Atrn	APN	2	130935565	missense	probably damaging	1.00
IGL02116:Atrn	APN	2	130958089	missense	probably damaging	1.00
IGL02372:Atrn	APN	2	131002754	splice site	probably benign
IGL02390:Atrn	APN	2	131020977	missense	possibly damaging	0.82
IGL02548:Atrn	APN	2	130972282	missense	probably damaging	1.00
IGL02749:Atrn	APN	2	130970144	nonsense	probably null
IGL02749:Atrn	APN	2	130947734	splice site	probably benign
BB010:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
BB020:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R0026:Atrn	UTSW	2	130957920	missense	probably damaging	1.00
R0403:Atrn	UTSW	2	130906859	missense	probably damaging	1.00
R0479:Atrn	UTSW	2	130999165	nonsense	probably null
R0544:Atrn	UTSW	2	130986826	missense	probably damaging	1.00
R0570:Atrn	UTSW	2	130980134	missense	probably benign	0.01
R0606:Atrn	UTSW	2	130906856	missense	possibly damaging	0.90
R0617:Atrn	UTSW	2	130995085	critical splice donor site	probably null
R0658:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R1108:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1112:Atrn	UTSW	2	130999161	missense	probably benign	0.04
R1219:Atrn	UTSW	2	131021007	missense	possibly damaging	0.90
R1422:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1524:Atrn	UTSW	2	130957080	missense	probably benign	0.15
R1653:Atrn	UTSW	2	130935624	missense	probably benign
R1795:Atrn	UTSW	2	130972288	missense	probably benign
R1807:Atrn	UTSW	2	130982772	missense	possibly damaging	0.94
R1920:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1935:Atrn	UTSW	2	130958035	missense	probably damaging	1.00
R1982:Atrn	UTSW	2	130970222	missense	probably benign
R2000:Atrn	UTSW	2	130935588	missense	probably damaging	1.00
R2143:Atrn	UTSW	2	130957996	missense	probably benign	0.03
R2336:Atrn	UTSW	2	130957954	missense	probably damaging	1.00
R2679:Atrn	UTSW	2	130961675	critical splice donor site	probably null
R3426:Atrn	UTSW	2	131020956	missense	probably benign	0.06
R3909:Atrn	UTSW	2	130994207	missense	probably damaging	1.00
R4077:Atrn	UTSW	2	130964930	critical splice donor site	probably null
R4162:Atrn	UTSW	2	130994228	splice site	probably benign
R4195:Atrn	UTSW	2	130933412	missense	probably damaging	1.00
R4364:Atrn	UTSW	2	130970208	missense	probably benign	0.39
R4465:Atrn	UTSW	2	130960468	missense	probably benign	0.08
R4510:Atrn	UTSW	2	130935577	nonsense	probably null
R4511:Atrn	UTSW	2	130935577	nonsense	probably null
R4527:Atrn	UTSW	2	130973504	missense	probably benign	0.10
R4586:Atrn	UTSW	2	130982042	missense	probably damaging	1.00
R4592:Atrn	UTSW	2	130999130	intron	probably benign
R4658:Atrn	UTSW	2	130933429	missense	probably damaging	1.00
R4735:Atrn	UTSW	2	131020990	missense	probably benign	0.06
R4960:Atrn	UTSW	2	130995047	nonsense	probably null
R4999:Atrn	UTSW	2	130975954	missense	probably damaging	1.00
R5066:Atrn	UTSW	2	130994193	missense	possibly damaging	0.60
R5080:Atrn	UTSW	2	130970124	missense	possibly damaging	0.95
R5141:Atrn	UTSW	2	130999130	intron	probably benign
R5256:Atrn	UTSW	2	130946019	missense	probably benign	0.39
R5494:Atrn	UTSW	2	131023075	missense	probably damaging	1.00
R5678:Atrn	UTSW	2	130970016	missense	probably damaging	0.96
R5752:Atrn	UTSW	2	130906544	unclassified	probably benign
R5931:Atrn	UTSW	2	130933436	missense	possibly damaging	0.56
R6023:Atrn	UTSW	2	131020980	missense	probably benign	0.25
R6176:Atrn	UTSW	2	130946091	missense	probably benign	0.31
R6377:Atrn	UTSW	2	130979969	missense	probably damaging	1.00
R6433:Atrn	UTSW	2	131023027	missense	probably damaging	1.00
R7226:Atrn	UTSW	2	130986744	missense	probably damaging	0.99
R7402:Atrn	UTSW	2	130947600	missense	probably damaging	1.00
R7541:Atrn	UTSW	2	130961571	missense	possibly damaging	0.46
R7587:Atrn	UTSW	2	130980114	missense	probably damaging	1.00
R7872:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R7910:Atrn	UTSW	2	130964887	missense	probably benign	0.04
R7913:Atrn	UTSW	2	130970211	missense	probably damaging	1.00
R7933:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R8044:Atrn	UTSW	2	130935529	missense	probably damaging	1.00
R8079:Atrn	UTSW	2	131013641	missense	probably null	1.00
R8093:Atrn	UTSW	2	130975988	missense	probably benign	0.00
R8203:Atrn	UTSW	2	130960549	missense	probably benign	0.00
R8234:Atrn	UTSW	2	131023000	critical splice acceptor site	probably null
R8462:Atrn	UTSW	2	130935584	missense	probably damaging	1.00
R8816:Atrn	UTSW	2	130906878	missense	probably damaging	1.00
R8816:Atrn	UTSW	2	131004574	missense	probably damaging	1.00
R8831:Atrn	UTSW	2	130906601	missense	probably benign	0.22
R8937:Atrn	UTSW	2	130999237	missense	probably benign	0.00
R9161:Atrn	UTSW	2	130935550	missense	probably damaging	1.00
R9722:Atrn	UTSW	2	130961616	missense	probably damaging	1.00
R9786:Atrn	UTSW	2	130944889	missense	probably damaging	1.00
RF009:Atrn	UTSW	2	130906922	missense	probably benign	0.12
X0024:Atrn	UTSW	2	130958139	missense	probably damaging	1.00
Z1088:Atrn	UTSW	2	130973399	missense	probably benign
Z1176:Atrn	UTSW	2	130946193	missense	probably benign	0.27
Z1177:Atrn	UTSW	2	130946042	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCTGGTGTAAATTACTGAGCAG -3'
(R):5'- GCTAACTGCTCTGGATGACC -3'

Sequencing Primer
(F):5'- GCAGTTAGCAGAAACATTCCTG -3'
(R):5'- CCCCCAAGCATTTATCATT -3'

Posted On

2014-07-14