Incidental Mutation 'R1921:Fbxl5'
ID213043
Institutional Source Beutler Lab
Gene Symbol Fbxl5
Ensembl Gene ENSMUSG00000039753
Gene NameF-box and leucine-rich repeat protein 5
SynonymsFbl4, Fir4
MMRRC Submission 039939-MU
Accession Numbers

Genbank: NM_001159963.1, NM_178729.4; Ensemble: ENSMUST00000114047, ENSMUST00000114047, ENSMUST00000119523, ENSMUST00000141902, ENSMUST00000087465, ENSMUST00000121736, ENSMUST00000124610                                     

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1921 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location43744615-43821638 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43765490 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 189 (E189D)
Ref Sequence ENSEMBL: ENSMUSP00000109681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047857] [ENSMUST00000087465] [ENSMUST00000114047] [ENSMUST00000119523] [ENSMUST00000121736] [ENSMUST00000124610] [ENSMUST00000196483] [ENSMUST00000199055]
Predicted Effect probably benign
Transcript: ENSMUST00000047857
AA Change: E195D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000045792
Gene: ENSMUSG00000039753
AA Change: E195D

DomainStartEndE-ValueType
Pfam:Hemerythrin 6 138 1.3e-10 PFAM
FBOX 208 248 2.31e-9 SMART
low complexity region 289 310 N/A INTRINSIC
LRR 355 379 2.43e2 SMART
LRR 382 407 4.87e-4 SMART
low complexity region 481 492 N/A INTRINSIC
LRR 596 621 2.45e0 SMART
LRR 624 649 4.65e-1 SMART
Blast:LRR 650 681 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000087465
AA Change: E195D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000084733
Gene: ENSMUSG00000039753
AA Change: E195D

DomainStartEndE-ValueType
Pfam:Hemerythrin 6 138 4.3e-15 PFAM
FBOX 208 248 2.31e-9 SMART
low complexity region 289 310 N/A INTRINSIC
LRR 355 379 2.43e2 SMART
LRR 382 407 4.87e-4 SMART
low complexity region 481 492 N/A INTRINSIC
LRR 596 621 1.23e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114047
AA Change: E189D

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109681
Gene: ENSMUSG00000039753
AA Change: E189D

DomainStartEndE-ValueType
Pfam:Hemerythrin 19 132 4.4e-11 PFAM
FBOX 202 242 2.31e-9 SMART
low complexity region 283 304 N/A INTRINSIC
LRR 349 373 2.43e2 SMART
LRR 376 401 4.87e-4 SMART
low complexity region 475 486 N/A INTRINSIC
LRR 590 615 2.45e0 SMART
LRR 618 643 4.65e-1 SMART
Blast:LRR 644 675 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000119523
AA Change: E178D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113557
Gene: ENSMUSG00000039753
AA Change: E178D

DomainStartEndE-ValueType
Pfam:Hemerythrin 6 121 2.2e-9 PFAM
FBOX 191 231 2.31e-9 SMART
low complexity region 272 293 N/A INTRINSIC
LRR 338 362 2.43e2 SMART
LRR 365 390 4.87e-4 SMART
low complexity region 464 475 N/A INTRINSIC
LRR 579 604 2.45e0 SMART
LRR 607 632 4.65e-1 SMART
Blast:LRR 633 664 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000121736
AA Change: E152D

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000112444
Gene: ENSMUSG00000039753
AA Change: E152D

DomainStartEndE-ValueType
PDB:3V5Z|B 1 118 2e-71 PDB
FBOX 165 205 2.31e-9 SMART
low complexity region 246 267 N/A INTRINSIC
LRR 312 336 2.43e2 SMART
LRR 339 364 4.87e-4 SMART
low complexity region 438 449 N/A INTRINSIC
LRR 553 578 1.23e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124421
Predicted Effect probably benign
Transcript: ENSMUST00000124610
AA Change: E195D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116720
Gene: ENSMUSG00000039753
AA Change: E195D

DomainStartEndE-ValueType
Pfam:Hemerythrin 6 138 5.7e-12 PFAM
FBOX 208 248 1.5e-11 SMART
low complexity region 289 310 N/A INTRINSIC
LRR 355 379 1e0 SMART
LRR 382 407 2e-6 SMART
low complexity region 481 492 N/A INTRINSIC
LRR 596 621 1e-2 SMART
LRR 624 649 1.9e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000141902
AA Change: E115D
SMART Domains Protein: ENSMUSP00000120338
Gene: ENSMUSG00000039753
AA Change: E115D

DomainStartEndE-ValueType
PDB:3V5Z|B 2 82 3e-43 PDB
FBOX 129 169 2.31e-9 SMART
low complexity region 210 231 N/A INTRINSIC
LRR 276 300 2.43e2 SMART
LRR 303 328 4.87e-4 SMART
low complexity region 402 413 N/A INTRINSIC
LRR 517 542 2.45e0 SMART
LRR 545 570 4.65e-1 SMART
Blast:LRR 571 602 3e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143316
Predicted Effect probably benign
Transcript: ENSMUST00000196483
AA Change: E195D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000143703
Gene: ENSMUSG00000039753
AA Change: E195D

DomainStartEndE-ValueType
Pfam:Hemerythrin 6 138 1.3e-10 PFAM
FBOX 208 248 2.31e-9 SMART
low complexity region 289 309 N/A INTRINSIC
LRR 354 378 2.43e2 SMART
LRR 381 406 4.87e-4 SMART
low complexity region 480 491 N/A INTRINSIC
LRR 595 620 2.45e0 SMART
LRR 623 648 4.65e-1 SMART
Blast:LRR 649 680 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199055
SMART Domains Protein: ENSMUSP00000142582
Gene: ENSMUSG00000039753

DomainStartEndE-ValueType
Pfam:Hemerythrin 6 105 6.1e-7 PFAM
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains several tandem leucine-rich repeats. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before turning of the embryo with iron overload, growth retardation, and hemorrhage. Mice heterozygous for a knock-out allele exhibit abnormal iron homeostasis when fed a low iron diet. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,833,748 N568S probably damaging Het
A2m C A 6: 121,654,612 L623M probably benign Het
Abhd2 T C 7: 79,348,356 I212T possibly damaging Het
Adam7 A C 14: 68,512,625 S449A possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aox3 T C 1: 58,180,651 Y1137H probably damaging Het
Atp11b T C 3: 35,834,325 Y715H probably damaging Het
Atrn A G 2: 130,995,051 Y1145C probably damaging Het
Btbd7 A G 12: 102,793,796 I631T probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cfap45 A G 1: 172,545,112 E458G probably damaging Het
Cptp C T 4: 155,866,538 R157H probably damaging Het
Dcbld1 A C 10: 52,319,651 E318D possibly damaging Het
Ddr2 G T 1: 170,004,245 P197Q probably damaging Het
Dlg5 T C 14: 24,176,571 Y421C probably damaging Het
Dlgap2 A G 8: 14,843,624 K980E probably benign Het
Drc7 T C 8: 95,056,016 V3A unknown Het
Dst T C 1: 34,161,029 V96A probably damaging Het
Ect2l T C 10: 18,143,004 D548G possibly damaging Het
Efcab10 A T 12: 33,398,435 Y89F probably benign Het
Eif1ad CGAGGAGGAGGAGGAGGAGG CGAGGAGGAGGAGGAGG 19: 5,370,058 probably benign Het
Entpd6 A G 2: 150,758,812 T147A probably damaging Het
Fer1l6 T A 15: 58,625,231 S1217T probably damaging Het
Frem2 A T 3: 53,653,495 V1197D possibly damaging Het
Fsip2 T A 2: 82,980,783 L2482* probably null Het
Fsip2 A T 2: 82,986,820 D4299V probably benign Het
Gipc3 T A 10: 81,338,215 I242F probably damaging Het
Hoxb1 T A 11: 96,366,112 Y96N probably damaging Het
Ibsp A G 5: 104,310,212 E205G probably damaging Het
Ibtk A G 9: 85,703,082 S1170P probably benign Het
Igfn1 A G 1: 135,966,063 probably null Het
Iqsec1 A G 6: 90,662,895 S954P probably benign Het
Kalrn A T 16: 34,392,093 D28E probably benign Het
Lrmda T C 14: 22,577,870 F52L probably damaging Het
Lrp2 T C 2: 69,523,287 D543G probably damaging Het
Lrrtm3 T C 10: 64,088,378 T337A probably benign Het
Marf1 C T 16: 14,128,601 D1219N possibly damaging Het
Mkln1 A G 6: 31,428,178 K118R probably benign Het
Nedd4l T C 18: 65,167,575 probably null Het
Neu2 A G 1: 87,597,301 E336G probably benign Het
Nfasc A G 1: 132,610,805 F448S probably damaging Het
Nlrx1 C A 9: 44,254,134 E822* probably null Het
Nr5a1 T C 2: 38,694,096 Y437C probably damaging Het
Olfr1224-ps1 A G 2: 89,156,581 V198A probably benign Het
Olfr1353 T A 10: 78,970,141 L164* probably null Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Phtf1 C T 3: 103,969,122 Q13* probably null Het
Pnldc1 A G 17: 12,888,928 L525P possibly damaging Het
Ppl T A 16: 5,106,124 D162V possibly damaging Het
Prkdc T A 16: 15,714,215 S1448T possibly damaging Het
Ptgdr A G 14: 44,853,281 I340T probably benign Het
Recql T C 6: 142,365,589 I458M probably benign Het
Rrbp1 A T 2: 143,988,291 V652E probably benign Het
Rtp1 T A 16: 23,431,410 I175N probably damaging Het
Ryr1 A G 7: 29,054,944 M3523T probably damaging Het
S100a16 T C 3: 90,542,396 L62P probably damaging Het
Samd11 T C 4: 156,248,709 E364G probably damaging Het
Satb1 C A 17: 51,742,115 G603* probably null Het
Shroom3 T A 5: 92,962,365 probably null Het
Slc25a15 A G 8: 22,395,761 S3P probably benign Het
Socs2 A T 10: 95,413,038 L71* probably null Het
Sptbn1 T C 11: 30,104,469 E2208G probably damaging Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Susd1 T A 4: 59,412,191 T121S probably benign Het
Svs3b A T 2: 164,255,928 S158T probably benign Het
Synpo C T 18: 60,603,589 M428I probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar4 A G 10: 23,961,341 D283G probably damaging Het
Tango6 T A 8: 106,688,794 D82E probably benign Het
Tcof1 T C 18: 60,838,855 T127A possibly damaging Het
Tle3 G A 9: 61,411,340 probably null Het
Tmem45a A G 16: 56,822,302 F169L probably benign Het
Trp53rkb T A 2: 166,795,823 V233E probably damaging Het
Ttc7b C T 12: 100,415,130 probably null Het
Tubgcp3 A T 8: 12,621,932 L770* probably null Het
Tut1 G A 19: 8,966,102 G851D probably benign Het
Ubr1 G A 2: 120,930,968 T576I probably benign Het
Vmn1r125 T A 7: 21,272,605 Y143N probably damaging Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Vmn2r95 T A 17: 18,424,313 N70K probably benign Het
Wdr59 A T 8: 111,486,950 L311* probably null Het
Wnt2 A G 6: 18,030,253 L12P unknown Het
Xrn1 T C 9: 95,999,497 I700T probably benign Het
Ypel1 A G 16: 17,082,579 H98R probably benign Het
Zfp219 T C 14: 52,008,234 T434A probably benign Het
Zik1 A C 7: 10,490,016 C385G probably damaging Het
Other mutations in Fbxl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Fbxl5 APN 5 43765336 missense probably damaging 1.00
IGL00797:Fbxl5 APN 5 43758401 missense probably damaging 1.00
IGL00811:Fbxl5 APN 5 43758225 missense probably damaging 1.00
IGL01065:Fbxl5 APN 5 43745334 missense probably damaging 1.00
IGL01626:Fbxl5 APN 5 43758705 missense probably benign 0.00
IGL02285:Fbxl5 APN 5 43765348 missense possibly damaging 0.88
D3080:Fbxl5 UTSW 5 43758366 missense probably benign 0.00
PIT4498001:Fbxl5 UTSW 5 43750981 missense possibly damaging 0.73
R0195:Fbxl5 UTSW 5 43770798 missense probably damaging 1.00
R0647:Fbxl5 UTSW 5 43768069 missense probably damaging 0.98
R1540:Fbxl5 UTSW 5 43758636 missense possibly damaging 0.92
R1545:Fbxl5 UTSW 5 43770798 missense probably damaging 1.00
R1569:Fbxl5 UTSW 5 43765461 missense probably damaging 1.00
R3081:Fbxl5 UTSW 5 43750880 missense probably damaging 1.00
R3776:Fbxl5 UTSW 5 43758276 missense possibly damaging 0.57
R4096:Fbxl5 UTSW 5 43758241 missense probably benign 0.19
R4275:Fbxl5 UTSW 5 43762772 intron probably benign
R4383:Fbxl5 UTSW 5 43762963 intron probably benign
R4469:Fbxl5 UTSW 5 43768186 missense probably damaging 1.00
R4654:Fbxl5 UTSW 5 43765429 missense probably damaging 0.99
R5067:Fbxl5 UTSW 5 43758772 missense probably benign 0.00
R5093:Fbxl5 UTSW 5 43773554 missense probably damaging 1.00
R5696:Fbxl5 UTSW 5 43758840 missense possibly damaging 0.93
R5738:Fbxl5 UTSW 5 43762828 missense probably benign 0.30
R6029:Fbxl5 UTSW 5 43765404 missense probably damaging 0.96
R6185:Fbxl5 UTSW 5 43821552 missense probably benign 0.02
R6842:Fbxl5 UTSW 5 43773586 missense probably damaging 1.00
R7234:Fbxl5 UTSW 5 43758220 missense probably benign 0.08
R7563:Fbxl5 UTSW 5 43821549 missense probably benign 0.00
R7653:Fbxl5 UTSW 5 43758774 missense probably benign
R7842:Fbxl5 UTSW 5 43758603 missense probably damaging 1.00
R7860:Fbxl5 UTSW 5 43758676 missense probably benign 0.00
R8139:Fbxl5 UTSW 5 43758745 nonsense probably null
R8393:Fbxl5 UTSW 5 43768091 missense possibly damaging 0.94
RF012:Fbxl5 UTSW 5 43773505 missense probably damaging 1.00
X0065:Fbxl5 UTSW 5 43760798 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCTTGCCCAATGAACAGG -3'
(R):5'- ACTGATGAAGTATGATCTGGGCTG -3'

Sequencing Primer
(F):5'- CTCTTGCCCAATGAACAGGGTAAAG -3'
(R):5'- CTCACGGGTTCTTAACAAGTTCAAC -3'
Posted On2014-07-14