Incidental Mutation 'R1921:Ibsp'
ID213045
Institutional Source Beutler Lab
Gene Symbol Ibsp
Ensembl Gene ENSMUSG00000029306
Gene Nameintegrin binding sialoprotein
SynonymsBsp2, bone sialoprotein, BSP
MMRRC Submission 039939-MU
Accession Numbers

Genbank: NM_008318.3

Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R1921 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location104299171-104311469 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104310212 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 205 (E205G)
Ref Sequence ENSEMBL: ENSMUSP00000031246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031246]
Predicted Effect probably damaging
Transcript: ENSMUST00000031246
AA Change: E205G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031246
Gene: ENSMUSG00000029306
AA Change: E205G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:BSP_II 17 321 2.8e-127 PFAM
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a major structural protein of the bone matrix. It constitutes approximately 12% of the noncollagenous proteins in human bone and is synthesized by skeletal-associated cell types, including hypertrophic chondrocytes, osteoblasts, osteocytes, and osteoclasts. The only extraskeletal site of its synthesis is the trophoblast. This protein binds to calcium and hydroxyapatite via its acidic amino acid clusters, and mediates cell attachment through an RGD sequence that recognizes the vitronectin receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show reduced body weight/size, delayed long bone growth and mineralization with low bone turn over due to reduced osteoclast formation, delayed intramembranous ossification, progressive periodontal breakdown, and severe alveolar and mandibular bone loss. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,833,748 N568S probably damaging Het
A2m C A 6: 121,654,612 L623M probably benign Het
Abhd2 T C 7: 79,348,356 I212T possibly damaging Het
Adam7 A C 14: 68,512,625 S449A possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aox3 T C 1: 58,180,651 Y1137H probably damaging Het
Atp11b T C 3: 35,834,325 Y715H probably damaging Het
Atrn A G 2: 130,995,051 Y1145C probably damaging Het
Btbd7 A G 12: 102,793,796 I631T probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cfap45 A G 1: 172,545,112 E458G probably damaging Het
Cptp C T 4: 155,866,538 R157H probably damaging Het
Dcbld1 A C 10: 52,319,651 E318D possibly damaging Het
Ddr2 G T 1: 170,004,245 P197Q probably damaging Het
Dlg5 T C 14: 24,176,571 Y421C probably damaging Het
Dlgap2 A G 8: 14,843,624 K980E probably benign Het
Drc7 T C 8: 95,056,016 V3A unknown Het
Dst T C 1: 34,161,029 V96A probably damaging Het
Ect2l T C 10: 18,143,004 D548G possibly damaging Het
Efcab10 A T 12: 33,398,435 Y89F probably benign Het
Eif1ad CGAGGAGGAGGAGGAGGAGG CGAGGAGGAGGAGGAGG 19: 5,370,058 probably benign Het
Entpd6 A G 2: 150,758,812 T147A probably damaging Het
Fbxl5 T A 5: 43,765,490 E189D probably benign Het
Fer1l6 T A 15: 58,625,231 S1217T probably damaging Het
Frem2 A T 3: 53,653,495 V1197D possibly damaging Het
Fsip2 A T 2: 82,986,820 D4299V probably benign Het
Fsip2 T A 2: 82,980,783 L2482* probably null Het
Gipc3 T A 10: 81,338,215 I242F probably damaging Het
Hoxb1 T A 11: 96,366,112 Y96N probably damaging Het
Ibtk A G 9: 85,703,082 S1170P probably benign Het
Igfn1 A G 1: 135,966,063 probably null Het
Iqsec1 A G 6: 90,662,895 S954P probably benign Het
Kalrn A T 16: 34,392,093 D28E probably benign Het
Lrmda T C 14: 22,577,870 F52L probably damaging Het
Lrp2 T C 2: 69,523,287 D543G probably damaging Het
Lrrtm3 T C 10: 64,088,378 T337A probably benign Het
Marf1 C T 16: 14,128,601 D1219N possibly damaging Het
Mkln1 A G 6: 31,428,178 K118R probably benign Het
Nedd4l T C 18: 65,167,575 probably null Het
Neu2 A G 1: 87,597,301 E336G probably benign Het
Nfasc A G 1: 132,610,805 F448S probably damaging Het
Nlrx1 C A 9: 44,254,134 E822* probably null Het
Nr5a1 T C 2: 38,694,096 Y437C probably damaging Het
Olfr1224-ps1 A G 2: 89,156,581 V198A probably benign Het
Olfr1353 T A 10: 78,970,141 L164* probably null Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Phtf1 C T 3: 103,969,122 Q13* probably null Het
Pnldc1 A G 17: 12,888,928 L525P possibly damaging Het
Ppl T A 16: 5,106,124 D162V possibly damaging Het
Prkdc T A 16: 15,714,215 S1448T possibly damaging Het
Ptgdr A G 14: 44,853,281 I340T probably benign Het
Recql T C 6: 142,365,589 I458M probably benign Het
Rrbp1 A T 2: 143,988,291 V652E probably benign Het
Rtp1 T A 16: 23,431,410 I175N probably damaging Het
Ryr1 A G 7: 29,054,944 M3523T probably damaging Het
S100a16 T C 3: 90,542,396 L62P probably damaging Het
Samd11 T C 4: 156,248,709 E364G probably damaging Het
Satb1 C A 17: 51,742,115 G603* probably null Het
Shroom3 T A 5: 92,962,365 probably null Het
Slc25a15 A G 8: 22,395,761 S3P probably benign Het
Socs2 A T 10: 95,413,038 L71* probably null Het
Sptbn1 T C 11: 30,104,469 E2208G probably damaging Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Susd1 T A 4: 59,412,191 T121S probably benign Het
Svs3b A T 2: 164,255,928 S158T probably benign Het
Synpo C T 18: 60,603,589 M428I probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar4 A G 10: 23,961,341 D283G probably damaging Het
Tango6 T A 8: 106,688,794 D82E probably benign Het
Tcof1 T C 18: 60,838,855 T127A possibly damaging Het
Tle3 G A 9: 61,411,340 probably null Het
Tmem45a A G 16: 56,822,302 F169L probably benign Het
Trp53rkb T A 2: 166,795,823 V233E probably damaging Het
Ttc7b C T 12: 100,415,130 probably null Het
Tubgcp3 A T 8: 12,621,932 L770* probably null Het
Tut1 G A 19: 8,966,102 G851D probably benign Het
Ubr1 G A 2: 120,930,968 T576I probably benign Het
Vmn1r125 T A 7: 21,272,605 Y143N probably damaging Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Vmn2r95 T A 17: 18,424,313 N70K probably benign Het
Wdr59 A T 8: 111,486,950 L311* probably null Het
Wnt2 A G 6: 18,030,253 L12P unknown Het
Xrn1 T C 9: 95,999,497 I700T probably benign Het
Ypel1 A G 16: 17,082,579 H98R probably benign Het
Zfp219 T C 14: 52,008,234 T434A probably benign Het
Zik1 A C 7: 10,490,016 C385G probably damaging Het
Other mutations in Ibsp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Ibsp APN 5 104310068 missense probably benign 0.27
IGL02317:Ibsp APN 5 104302466 missense probably damaging 1.00
IGL02539:Ibsp APN 5 104302283 missense probably damaging 0.99
IGL03236:Ibsp APN 5 104306005 missense probably benign 0.30
crunch UTSW 5 104309282 missense probably damaging 1.00
I2289:Ibsp UTSW 5 104302487 missense possibly damaging 0.64
PIT4445001:Ibsp UTSW 5 104302304 missense possibly damaging 0.94
R0049:Ibsp UTSW 5 104302158 missense probably damaging 1.00
R0049:Ibsp UTSW 5 104302158 missense probably damaging 1.00
R0234:Ibsp UTSW 5 104310069 small deletion probably benign
R0610:Ibsp UTSW 5 104310134 missense probably benign 0.07
R0656:Ibsp UTSW 5 104310020 critical splice acceptor site probably null
R1168:Ibsp UTSW 5 104302152 missense probably damaging 0.99
R1440:Ibsp UTSW 5 104310539 missense unknown
R1569:Ibsp UTSW 5 104310151 missense probably damaging 1.00
R2172:Ibsp UTSW 5 104310430 missense probably damaging 1.00
R2879:Ibsp UTSW 5 104310394 missense possibly damaging 0.88
R4399:Ibsp UTSW 5 104309282 missense probably damaging 1.00
R4517:Ibsp UTSW 5 104305997 nonsense probably null
R5417:Ibsp UTSW 5 104310469 missense possibly damaging 0.95
R5575:Ibsp UTSW 5 104310059 missense possibly damaging 0.78
R6183:Ibsp UTSW 5 104306030 missense possibly damaging 0.95
R6273:Ibsp UTSW 5 104310301 missense probably benign 0.15
R6295:Ibsp UTSW 5 104302121 splice site probably null
R7061:Ibsp UTSW 5 104309902 splice site probably null
R7133:Ibsp UTSW 5 104302306 nonsense probably null
R7202:Ibsp UTSW 5 104302161 missense probably benign 0.02
R7205:Ibsp UTSW 5 104310431 missense probably damaging 0.99
R7769:Ibsp UTSW 5 104306005 missense probably benign 0.15
R7769:Ibsp UTSW 5 104310184 missense probably damaging 0.97
R8506:Ibsp UTSW 5 104310081 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATTCCTTTCCAGGCTGG -3'
(R):5'- TAAGCTCGGTAAGTGTCGCC -3'

Sequencing Primer
(F):5'- TCCAGGCTGGAGATGCAG -3'
(R):5'- CCATACTCAACGGTGCTGC -3'
Posted On2014-07-14